, Caridina nilotica var. brachydactyla -Lenz, p.568, 1910.

. Roux, , pp.303-304, 1929.

, Caridina nilotica var. gracilipes -Lenz, p.568, 1910.

. Caridina-brachydactyla-brachydactyla--costa, , 1980.

, ZMA.CRUS.D.102886, 1? ovig. cl 6.4mm; Umgeni River, 1908.

. C. Zma, , 102886.

. Caridina-nilotica-var.-brachydactyla-de-man, , 1908.

M. Weber,

P. Luwu, . M. Sulawesi, and . Weber,

R. Caridina-brevidactyla, , 1920.

. Paralectotypes,

U. Aru and . Island, , 1908.

W. Vic, W. Island, and A. , , 1908.

, Caridina gracilipes De Man, p.1, 1908.

, DNA:CA024) and 5.6mm; in a rice field, 1? ovig. cl 5.9mm (DNA: CA023), 3? cl 5.1mm (DNA: CA027), 5.2mm

H. M. Caridina and . Edwards, Oran. MNHN IU, vol.1837, 2013.

. Mnhn-iu-, 1? ovig. cl 5.0mm (DNA: CA1575) and MNHN, p.1, 2018.

. Mazancourt, MNHN-IU-2018-221, 1? ovig. cl 5.6mm and MNHN-IU-2018-222, 1? ovig, 2016.

&. V. Marquet and . De-mazancourt, , 2016.

. Mazancourt, , 2016.

C. Var, gracilipes. NMB 1061h, 1? cl 3.7mm; River La Foa, coll. F. Sarasin and J

. Roux, , p.2, 1912.

C. Koné and R. Sarasin, , 1911.

, Caridina wyckii var. gracilipes De Man, 1892 NEW CALEDONIA. BPBM S5060, 1? cl 4.2mm, coll. F. X. Williams, 1940. Comparative material: Caridina brachydactyla De Man, 1908.

. Caridina-nilotica-var.-brachydactyla-de-man, Lectotype. RMNH.CRUS.D, vol.977, 1908.

R. C. Palopo, . Luwu, .. M. Sulawesi, and . Weber, Other material: INDONESIA. C. brachydactyla: NMB 1054a

C. P. Bali and . Wirz, WK 63-10, 2? cl 2.7mm (DNA: CA1129) and 3.7mm (DNA: CA1130) 1? ovig cl 4, 1926.

M. Palopo and 0. Sulawesi, , 2010.

T. Palopo, .. W. Sulawesi, and . Klotz, , 2010.

, Not Caridina nilotica var. meridionalis. AUSTRALIA. NMB 1054d

C. Creek, N. Cook-town, and . Queensland, , 1923.

, DNA: CA1411, pp.2016-11764

?. Ovig, DNA: CA1412); 1 ?, cl 5.0 mm, 'W, Tuafaleloa river, 2014.

?. Ovig, 13°51.900'S 171° 41.196'W, Ma'epu river, pp.2016-11767, 2014.

, Type material Caridina weberi De Man, 1892. Syntypes: 2 ?, cl 4.4-4.5 mm and 1 ? ovig, cl 6.1 mm, pp.2015-1755

G. Warka, . Kei-island, and H. Indonesia, Merton coll., NMB 6.IV.b. Paralectotypes: 2 ? cl 2.6mm, 1 ? 6.IV.b, same data as for lectotype, NMB 6.IV.a; 1 ?, cl 5.5mm and 1 ?, cl 3.4mm, same data as for lectotype, NMB 6.IV.b. Caridina weberi De Man, 1892. Syntypes: 2 ?, Lectotype: 1 ? ovig. cl 5.7mm, pp.2015-1755, 1908.

, Références bibliographiques

A. Abdou, Amphidromie et phylogéographie des Neritidae (Mollusca: Gastropoda) des rivières Indo--Pacifiques, Ecole doctorale de l'Ecole Pratique des Hautes Etudes, p.397, 2016.

R. Abell, M. L. Thieme, C. Revenga, M. Bryer, M. Kottelat et al., Freshwater Ecoregions of the World: A New Map of Biogeographic Units for Freshwater Biodiversity Conservation, BioScience, vol.58, issue.5, pp.403-414, 2008.

F. A. Abrunhosa and M. G. Moura, O completo desnvolvimento larval do camarao Atya scabra (Leach) (Crustacea: Decapoda: Atyidae), cultivado em laboratorio. Arquivos de Ciências do Mar, vol.27, 1988.

A. M. Adamson, Non--marine Invertebrate Fauna of the Marquesas (Exclusive of insects), Occasional Papers Bernice P. Bishop Museum, vol.11, issue.10, pp.1-39, 1935.

A. M. Adamson, Review of the fauna of the Marquesas islands and discussion of its origin, Occasional Papers Bernice P. Bishop Museum, vol.159, pp.1-93, 1939.

P. G. Albano, B. Sabelli, and P. Bouchet, The challenge of small and rare species in marine biodiversity surveys: microgastropod diversity in a complex coastal environment, Biodiversity and Conservation, vol.20, issue.13, pp.3223-3237, 2011.

,

D. Annawaty-&-wowor, The atyid shrimps from Lake Lindu, Central Sulawesi, Indonesia with description of two new species (Crustacea: Decapoda: Caridea), 2015.

, Zootaxa, vol.3957, issue.5, pp.501-519

K. D. Arudpragasam and H. H. Costa, Atyidae of Ceylon --I, Crustaceana, vol.4, pp.7-24, 1962.

J. M. Atkinson, Larval development of a freshwater prawn, Macrobrachium lar (Decapoda, Palaemonidae), reared in the laboratory, Crustaceana, vol.33, issue.2, pp.119-132, 1977.

N. Babu, Observations on the biology of Caridina propinqua De Man, Indian Journal of Fisheries, vol.10, pp.107-117, 1963.

H. Bandelt, P. Forster, and A. Röhl, Median--joining networks for inferring intraspecific phylogenies, Molecular Biology and Evolution, pp.37-48, 1999.

K. H. Barnard, Descriptive catalogue of South African Decapod Crustacea, Annals of the South African Museum, vol.38, pp.1-864, 1950.

C. J. Barthélémy, M. P. Sur, and . Roux, , vol.3, pp.xliv-li, 1834.

R. T. Bauer, Amphidromy in shrimps: a life cycle between rivers and the sea, Latin American Journal of Aquatic Research, vol.41, issue.4, pp.633-650, 2013.

F. M. Bayer and H. A. Fehlmann, The discovery of a freshwater opisthobranchiate mollusk, Acochlidium amboinense Strubell, in the Palau Islands, Proceedings of the Biological Society of Washington, vol.73, pp.183-193, 1960.

J. P. Benstead, J. G. March, C. M. Pringle, K. C. Ewel, and J. W. Short, Biodiversity and ecosystem function in species--poor sommunities: community structure and leaf litter breakdown in a Pacific island stream, Journal of the North American Benthological Society, vol.28, issue.2, pp.454-465, 2009.

J. A. Benzie, The Complete Larval Development of Caridina Mccullochi Roux, 1926 (Decapoda, Atyidae) Reared in the Laboratory, Journal of Crustacean Biology, vol.2, issue.4, pp.493-513, 1982.

J. A. Benzie and P. K. Silva, The abbreviated larval development of Caridina singhalensis Ortmann, 1894 (Decapoda, Atyidae), Journal of Crustacean Biology, vol.3, issue.1, pp.117-126, 1983.

S. C. Bernardes, A. R. Pepato, ;. Rintelen, K. Page, T. J. Freitag et al., The complex evolutionary history and phylogeography of Caridina typus (Crustacea: Decapoda): long--distance dispersal and cryptic allopatric species, Rintelen (von), vol.7, p.9044, 2017.

K. Beurlen, Alguns restos de Crustáceos Decápodes d'água doce fósseis no Brasil. Anais da Academia Brasileira de Ciéncias, vol.22, pp.453-459, 1950.

P. Bird, An updated digital model of plate boundaries, Geochemistry, Geophysics, Geosystems, issue.3, p.4, 2003.

C. Bocquet, J. Génermont, and M. Lamotte, Les problèmes de l'espèce dans le règne animal. Société Zoologique de France, pp.17-28, 1976.

E. Bordage, Recherches expérimentales sur les mutations évolutives de certains Crustacés de la famille des Atyidés, Comptes rendus de l'Académie des Sciences, vol.147, pp.1418-1421, 1908.

I. V. Borkin, Ichtyoplankton of western Spitzbergen coastal waters, Journal of Ichthyology, vol.31, pp.680-685, 1991.

D. Boseto, C. Morrison, P. Pikacha, and T. Pitakia, Biodiversity and conservation of freshwater fishes in selected rivers on Choiseul Island, Solomon Islands, The South Pacific Journal of Natural Science, vol.3, issue.1, pp.16-21, 2007.

,

F. Bossuyt, M. Meegaskumbura, N. Beenaerts, D. J. Gower, R. Pethiyagoda et al., Local endemism within the Western Ghats--Sri Lanka biodiversity hotspot, Science, vol.306, issue.5695, pp.479-481, 2004.

,

A. Botello, T. M. Iliffe, F. Alvarez, C. Juan, J. Pons et al., Historical biogeography and phylogeny of Typhlatya cave shrimps (Decapoda: Atyidae) based on mitochondrial and nuclear data, Journal of Biogeography, vol.40, issue.3, pp.594-607, 2013.

Y. Bouligand, Twisted fibrous arrangements in biological materials and cholesteric mesophases, Tissue and Cell, vol.4, issue.2, pp.189-217, 1972.

, , pp.80042-80051

E. L. Bouvier, Crevettes de la famille des Atyidés: espèces qui font partie des collections du Muséum d'Histoire naturelle, Bulletin du Muséum national d'Histoire naturelle, vol.10, pp.129-138, 1904.

E. L. Bouvier, Observations nouvelles sur les crevettes de la famille des Atyidés, Bulletin scientifique de France et de Belgique, vol.39, pp.5-134, 1905.

E. L. Bouvier, Dugastella marocana, crevette primitive nouvelle de la famille des Atyidés, Comptes Rendus hebdomadaires des Séances de l'Académie des Sciences, vol.155, pp.993-998, 1912.

E. L. Bouvier, Un type nouveaux de crevette d'eau douce africaine, la Caridinopsis Chevalieri nov. gen et sp, Bulletin du Muséum national d'Histoire naturelle, vol.18, pp.300-303, 1912.

E. L. Bouvier, Sur la classification des crevettes de la famille des Atyidés, 1913.

E. L. Bouvier, Recherches sur la morphologie, les variations, la distribution géographique des crevettes de la famille des, Atyidae. Encyclopédie entomologique, vol.4, pp.1-370, 1925.

B. W. Bowen, M. R. Gaither, J. D. Dibattista, M. Iacchei, K. R. Andrews et al., Comparative phylogeography of the ocean planet, Proceeding of the National Academy of Sciences, vol.113, issue.29, pp.7962-7969, 2016.

,

H. D. Bracken, S. De-grave, and D. L. Felder, Phylogeny of the infraorder Caridea based on mitochondrial and nuclear genes (Crustacea: Decapoda), 2009.

, Decapod crustacean phylogenetics, pp.281-305

J. C. Briggs, Global Biogeography (Developments in Palaeontology and Stratigraphy, vol.14, 1995.

J. C. Briggs, Coincident biogeographic patterns: Indo--West Pacific Ocean, Evolution, vol.53, issue.2, pp.326-335, 1999.

G. R. Bright, Report: Office Chief Conserv. Trust Territory of the Pacific Islands, 1979.

G. R. Bright, The freshwater decapod crustaceans of Yap, Caroline Islands, pp.33-36, 1989.

A. J. Bruce, Pycnisia raptor, a new genus and species of predatory troglobitic shrimp (Crustacea: Decapoda: Atyidae) from northern Australia, Invertebrate Systematics, vol.6, issue.3, pp.553-566, 1992.

D. Bryant, C. Semple, and M. Steel, Phylogenetic supertrees: Combining information to reveal the tree of life, pp.129-150, 2004.

R. W. Buddemeier, J. E. Maragos, and D. W. Knutson, Radiographic studies of reef coral exoskeletons: Rates and patterns of coral growth, Journal of Experimental Marine Biology and Ecology, vol.14, issue.74, pp.90024-90024, 1974.

D. W. Buden, D. B. Lynch, J. W. Short, and T. Leberer, Decapod crustaceans of the headwater streams of Pohnpei, eastern Caroline Islands, Federated States of Micronesia, Pacific Science, vol.55, issue.3, pp.257-265, 2001.

,

A. Burns and K. F. Walker, Biofilms as food for decapods (Atyidae, Palaemonidae) in the River Murray, vol.437, pp.83-90, 2000.

Y. Cai, Atydina, a new genus for Caridina atyoides Nobili, from Indonesia (Crustacea: Decapoda: Atyidae), vol.2372, pp.75-79, 1900.

Y. Cai, Caridina jeani a replacement name for Caridina typus var. brevirostris J. Roux, 1911 from Eastern Indonesia (Crustacea: Decapoda: Atyidae), Contributions to shrimp taxonomy. Zootaxa, pp.80-84, 2010.

Y. Cai, Atyid shrimps of Hainan Island, southern China, with the description of a new species of Caridina (Crustacea, Decapoda, Atyidae), Advances in Freshwater Decapod Systematics and Biology, pp.207-231, 2014.

Y. Cai and A. Anker, On a collection of freshwater shrimps (Crustacea Decapoda Caridea) from the Philippines, with descriptions of five new species, Tropical Zoology, vol.17, pp.233-266, 2004.

Y. Cai and M. M. Bahir, Lancaris, a new genus of freshwater shrimp from Sri Lanka (Crustacea: Decapoda: Atyidae), Raffles Bulletin of Zoology Suppl, vol.12, pp.39-46, 2005.

Y. Cai, S. C. Choy, and P. K. Ng, Epigean and hypogean freshwater shrimps of Bohol Island, Central Philippines (Crustacea: Decapoda: Caridea). The Raffles Bulletin of Zoology, vol.57, pp.65-89, 2009.

Y. Cai and N. K. Ng, A revision of the Caridina serrata species group, with descriptions of five new species (Crustacea: Decapoda: Caridea: Atyidae), Journal of Natural History, vol.33, pp.1603-1638, 1999.

Y. Cai and P. K. Ng, The freshwater decapod crustaceans of Halmahera, Indonesia. Journal of Crustacean Biology, vol.21, issue.3, pp.665-695, 2001.

,

Y. Cai and P. K. Ng, Marosina, a new genus of troglobitic shrimps (Decapoda, Atyidae) from Sulawesi, Indonesia, with descriptions of two new species, 2005.

, Crustaceana, vol.78, issue.2, pp.129-139

Y. Cai and P. K. Ng, A revision of the Caridina gracilirostris De Man, 1892, species group, with descriptions of two new taxa (Decapoda; Caridea; Atyidae), Journal of Natural History, pp.1585-1602, 2007.

,

Y. Cai and P. K. Ng, The freshwater shrimps of the genera Caridina and Parisia from karst caves of Sulawesi Selatan, Indonesia, with descriptions of three new species (Crustacea: Decapoda: Caridea: Atyidae), Journal of Natural History, vol.43, pp.1093-1114, 2009.

Y. Cai, P. K. Ng, and S. C. Choy, Freshwater shrimps of the family Atyidae (Crustacea: Decapoda: Caridea) from Peninsular Malaysia and Singapore. The Raffles Bulletin of Zoology, vol.55, pp.277-309, 2007.

Y. Cai, P. K. Ng, S. Shokita, and K. Satake, On the species of Japanese Atyid shrimps (Decapoda: Caridea) described by William Stimpson (1860), Journal of Crustacean Biology, vol.26, issue.3, pp.392-419, 2006.

Y. Cai and S. Shokita, Atyid shrimps (Crustacea: Decapoda: Caridea) of the Ryukyu Islands, southern Japan, with descriptions of two new species, Journal of Natural History, vol.40, pp.2123-2172, 2006.

Y. Cai and S. Shokita, Report on a collection of freshwater shrimps (Crustacea: Decapoda: Caridea) from the Philippines, with descriptions of four new species. The Raffles Bulletin of Zoology, vol.54, pp.245-270, 2006.

W. T. Calman, On two species of macrurous crustaceans from Lake Tanganyika, Proceedings of the Zoological Society of London, vol.67, issue.3, pp.704-712, 1899.

W. T. Calman, Zoological results of the third Tanganyika Expedition, Report on the macrurous Crustacea. Proceedings of the Zoological Society of London, vol.76, pp.187-206, 1906.

W. T. Calman, On freshwater prawns of the family Atyidae from Queensland. The Annals and Magazine of Natural History, vol.17, pp.241-246, 1926.

P. Cals, Jolivetya foresti n. gen. n. sp. (Crustacea Natantia), forme cavernicole continentale pacifique, élément d'un ensemble gondwanien australo--malgache, 1986.

, Comptes Rendus hebdomadaires des Séances de l'Académie des Sciences, vol.303, pp.387-390

A. P. Candolle-;-de), Théorie élémentaire de la Botanique, ou exposition des principes de la classification naturelle et de l'art de décrire et d'étudier les végétaux, 1813.

. Déterville,

M. Castelin, P. Feutry, M. Hautecoeur, G. Marquet, D. Wowor et al., New insight on population genetic connectivity of widespread amphidromous prawn Macrobrachium lar (Fabricius, 1798)(Crustacea: Decapoda: Palaemonidae), vol.160, pp.1395-1406, 2013.

,

M. Castelin, G. Marquet, and W. Klotz, Elephantis, a new genus for Caridina natalensis Bouvier, 1925 from eastern rivers of Madagascar, Zootaxa, vol.3702, issue.6, pp.573-586, 2013.

D. M. Ceccarelli, A. D. Mckinnon, S. Andréfouët, V. Allain, J. Young et al., Chapter Four --The Coral Sea: Physical Environment, Ecosystem Status and Biodiversity Assets, Advances in Marine Biology, pp.213-290, 2013.

F. A. Chace, The Atya--like shrimps of the Indo--Pacific Region (Decapoda: Atyidae), Smithsonian Contributions to Zoology, vol.384, pp.1-54, 1983.

F. A. Chace, On the classification of the Caridea (Decapoda), Crustaceana, vol.63, pp.70-80, 1992.

F. A. Chace, The Caridean Shrimps (Crustacea: Decapoda) of the Albatross Philippine Expedition, Part 7: Families Atyidae, Eugonatonotidae, Rhynchocinetidae, Bathypalaemonidae, Processidae, and Hippolytidae (Smithsonian Contributions to Zoology, vol.587, 1907.

R. Chapman, Conventional Procrustes approaches, Proceedings of the Michigan Morphometrics Workshop, pp.251-267, 1990.

X. Chen and F. He, Speciation and endemism under the model of island biogeography, Ecology, vol.90, issue.1, pp.39-45, 2009.

S. F. Chenoweth and J. M. Hughes, Speciation and phylogeography in Caridina indistincta, a complex of freshwater shrimps from Australian heathland streams. Marine and Freshwater Research, vol.54, pp.807-812, 2003.

,

B. Chinnaya, The embryonic and larval development of Caridina weberi de Man in the laboratory (Decapoda, Atyidae). Broteria, series trimestrial -ciencias naturais, vol.43, pp.119-134, 1974.

B. Chopra and K. K. Tiwari, Decapod Crustacea of the Patna State, Orissa. Records of the Indian Museum, vol.45, pp.213-224, 1949.

S. C. Choy, The atyid shrimps of Fiji with description of a new species, Zoologische Mededelingen, vol.65, issue.27, pp.343-362, 1991.

S. C. Choy, Caridina bruneiana, a new species of freshwater shrimp (Decapoda, Caridea, Atyidae) from Negara Brunei Darussalam, Zoologica Scripta, vol.21, pp.49-55, 1992.

S. C. Choy and G. Marquet, Biodiversity and Zoogeography of Atyid shrimps (Crustacea: Decapoda: Natantia) of New Caledonia, Zoologia Neocaledonica 5. Systématique et endémisme en NouvelleCalédonie. Mémoires du Muséum national d'Histoire naturelle, pp.223-231, 2002.

C. O. Coleman, Digital inking": how to make perfect line drawings on computers, Organisms Diversity and Evolution, vol.3, pp.1-14, 2003.

C. O. Coleman, Substituting time--consuming pencil drawings in arthropod taxonomy using stacks of digital photographs, Zootaxa, vol.1360, pp.61-68, 2006.

D. J. Colgan, W. F. Ponder, P. E. Eggler, T. J. Page, and J. M. Hughes, Gastropod evolutionary rates and phylogenetic relationships assessed using partial 28S rDNA and histone H3 sequences, Zoologica Scripta, vol.29, pp.273-289, 2000.

H. H. Costa, Results of the Austrian--Indian Hydrobiological Mission 1974 to the Seychelles--,Comores and Mascarene--Archipelagos: Part III: The Ecology and the Distribution of Decapoda Caridea in the Indian Ocean Islands of Seychelles, 1980.

. Serie-b-für-botanik-und-zoologie, , vol.83, pp.673-700

H. H. Costa, Results of the Austrian--Indian Hydrobiological Mission 1976 to the Andaman--Islands: Part V: Taxonomy and Ecology of the Decapoda--Caridea, 1984.

, Annalen des Naturhistorischen Museums in Wien. Serie B für Botanik und Zoologie, vol.86, pp.205-211

C. L. Couret and D. C. Wong, Larval development of Halocaridina rubra Holthuis (Decapoda, Atyidae), Crustaceana, vol.34, issue.3, pp.301-309, 1978.

,

A. P. Covich, T. A. Crowl, C. L. Hein, M. J. Townsend, and W. H. Mcdowell, Predator-prey interactions in river networks: comparing shrimp spatial refugia in two drainage basins, Freshwater Biology, vol.54, issue.3, pp.450-465, 2009.

A. P. Covich, M. A. Palmer, and T. A. Crowl, The role of benthic invertebrate species in freshwater ecosystems, BioScience, vol.49, pp.119-128, 1999.

,

D. A. Craig, D. C. Currie, and D. A. Joy, Geographical history of the central western Pacific black fly subgenus Inseliellum (Diptera: Simuliidae: Simulium) based on a reconstructed phylogeny of the species, hot archpelagoes and hydrological considerations, Journal of Biogeography, vol.28, issue.9, pp.1101-1127, 2001.

,

E. Crandall, J. Taffel, and P. Barber, High gene flow due to pelagic larval dispersal among South Pacific archipelagos in two amphidromous gastropods (Neritomorpha: Neritidae), Heredity, vol.104, issue.6, pp.563-572, 2010.

,

E. P. Creaser, The Cenotes of Yucatan. A zoological and hydrographic survey. Carnegie Institution of Washington, pp.117-132, 1936.

T. A. Crowl, W. H. Mcdowell, A. P. Covich, and S. L. Johnson, Freshwater shrimp effects on detrital processing and nutrients in a tropical headwater stream, Ecology, vol.82, issue.3, p.82, 2001.

N. Cumberlidge, J. Rasamy-razanabolana, C. H. Ranaivoson, H. H. Randrianasolo, C. Sayer et al., Updated extinction risk assessments of Madagascar's freshwater decapod crustaceans reveal fewer threatened species but more Data Deficient species, Malagasy Nature, vol.12, pp.32-41, 2017.

). Daday-;-von and E. , Der postembryonale Entwicklungsgang von Caridina wyckii (Hicks.). Zoologische Jahrbücher. Abteilung für Anatomie und Ontogenie der Tiere, vol.24, pp.239-294, 1907.

J. D. Dana, 1852) Conspectus of the Crustacea of the Exploring Expedition under Capt, The American Journal of Science and Arts, vol.14, issue.2, pp.116-125

D. Darriba, G. L. Taboada, R. Doallo, and D. Posada, 2: more models, new heuristics and parallel computing, Nature Methods, vol.9, issue.8, pp.772-772, 2012.

P. J. Davie, Crustacea: Malacostraca: Phyllocarida, Hoplocarida, Eucarida (Part 1), p.551, 2002.

K. E. Davis, S. De-grave, C. Delmer, and M. A. Wills, Freshwater transitions and symbioses shaped the evolution and extant diversity of caridean shrimps, Communications Biology, issue.16, p.1, 2018.

B. Dayrat, Towards integrative taxonomy, F. (1867) Descripção de algunas especies novas ou pouco coniecidas de Crustaceos e Arachnidos de Portugal e possessões Portuguezas do ultramar. Memorias da Academia Real de Lisboa, vol.85, pp.1-17, 2005.

S. De-grave, Rostral variation in Palaemon concinnus Dana, 1852 (Decapoda, Palaemonidae), Crustaceana, vol.72, issue.7, pp.701-704, 1999.

S. De-grave, Caridina nilotica. The IUCN Red List of Threatened Species, 2013.

. T. Rlts, S. En-de-grave, Y. Cai, and A. Anker, Global diversity of shrimps (Crustacea: Decapoda: Caridea) in freshwater, Freshwater Animal Diversity Assessment, vol.595, pp.287-293, 2008.

S. De-grave and C. Fransen, Carideorum catalogus: the recent species of the dendrobranchiate, stenopodidean, procarididean and caridean shrimps (Crustacea: Decapoda), Zoologische Mededelingen Leiden, vol.85, issue.9, pp.195-589, 2011.

S. De-grave, C. P. Li, L. M. Tsang, K. H. Chu, and T. Chan, Unweaving hippolytoid systematics (Crustacea, Decapoda, Hippolytidae): resurrection of several families, Zoologica Scripta, vol.43, issue.5, pp.496-507, 2014.

S. De-grave, K. G. Smith, N. A. Adeler, D. J. Allen, F. Alvarez et al., Dead Shrimp Blues: A Global Assessment of Extinction Risk in Freshwater Shrimps(Crustacea: Decapoda: Caridea), PLoS ONE, vol.10, issue.3, p.120198, 2015.

W. De-haan, Fauna Japonica sive Descriptio Animalium, quae in Itinere per Japoniam, Jussu et Auspiciis Superiorum, qui Summum in India Batava Imperium Tenent, Suspecto, Annis 1823-1830 Collegit, Notis, Observationibus et Adumbrationibus Illustravit., Lugduni Batavorum, pp.1-243

J. G. De-man, Carcinological studies in the Leyden Museum. Notes from the Leyden Museum, vol.14, pp.225-264, 1892.

J. G. De-man, Decapoden des Indischen Archipels, Zoologische Ergebnisse Reise Niederlandish Ost-Indien, pp.265-527, 1892.

J. G. De-man, Report on the Podophthalmous Crustacea, collected in the year 1891 by Dr H. ten Kate in some islands of the Malay Archipelago, Notes Leyden Museum, vol.15, pp.287-288, 1893.

J. G. De-man, Die von Herrn professor Kükenthal in Indischen Archipel gesammelten Dekapoden und Stomatopoden, Ergebnisse einer zoologischen Forschungsreise in den Molukken und Borneo. Abhandlungen der Senckenbergischen Naturforschenden Gesellschaft, pp.467-929, 1902.

J. G. De-man, On Caridina nilotica (Roux) and its varieties, Records of the Indian Museum, vol.2, pp.255-283, 1908.

K. De-queiroz, Species concepts and species delimitation, Systematic Biology, vol.56, issue.6, pp.879-886, 2007.

D. Silva and K. H. , Studies on Atyidae (Decapoda, Caridea) of Sri Lanka I. On a new species, a new subspecies, and two species new to Sri Lanka, Crustaceana, vol.43, issue.2, pp.127-141, 1982.

R. Desalle, M. G. Egan, and M. Siddall, The unholy trinity: taxonomy, species delimitation and DNA barcoding, Philosophical Transactions of the Royal Society B: Biological Sciences, vol.360, pp.1905-1916, 1462.

,

W. S. Devick, , 1991.

, Disturbances and fluctuations in the Wahiawa Reservoir Ecosystem, pp.1-20

A. Dimmock, I. Williamson, and P. B. Mather, The influence of environment on the morphology of Macrobrachium australiense (Decapoda: Palaemonidae), Aquaculture International, vol.12, pp.435-456, 2004.

,

M. Dormitzer, Troglocaris schmidtii. Lotos, vol.3, pp.85-88, 1853.

P. Drach, Mue et cycle d'intermue chez les Crustacés Décapodes, Annales de l'Institu Océanographique de Monaco, vol.19, pp.103-391, 1939.

P. Drach and C. Tchernigovtzeff, Sur la méthode de détermination des stades d'intermue et son application générale aux Crustacés, Vie et Milieu. Série A. Biologie Marine, vol.18, pp.595-610, 1967.

A. J. Drummond, M. A. Suchard, D. Xie, and A. Rambaut, Bayesian phylogenetics with BEAUti and the BEAST 1.7, Molecular Biology and Evolution, vol.29, issue.8, pp.1969-1973, 2012.

A. Dubois, Species and "strange species" in zoology: Do we need a "unified concept of species, Comptes Rendus Palevol, vol.10, pp.77-94, 2011.

,

D. Dudgeon, Large--Scale Hydrological Changes in Tropical Asia: Prospects for Riverine Biodiversity: The construction of large dams will have an impact on the biodiversity of tropical Asian rivers and their associated wetlands, BioScience, vol.50, issue.9, p.50, 2000.

J. Dupon, J. Bonvallot, E. Vigneron, J. C. Gay, C. Morhange et al., , 1993.

R. C. Edgar, MUSCLE: multiple sequence alignment with high accuracy and high throughput, Nucleic Acids Research, vol.32, issue.5, p.1792, 2004.

C. H. Edmonson, Atyidae of Southern Polynesia, Bernice P. Bishop Museum Occasional Papers, vol.11, issue.3, pp.1-19, 1935.

C. H. Edmonson, Substitute for an invalid generic name in the Crustacea, Pacific Science, vol.8, p.368, 1954.

T. Eichhorst and E. , ConchBooks, vol.1, 2016.

W. D. Emmerson, A Guide to, and Checklist for, the Decapoda of Namibia, South Africa and Mozambique, vol.1, 2016.

R. A. Englund and Y. Cai, The occurence and description of Neocaridina denticulata sinensis, Crustacea: Decapoda: Atyidae), a new introduction to the Hawaiian Islands. Bishop Museum Occasional Papers, vol.58, pp.58-65, 1918.

J. A. Esselstyn, Should universal guidelines be applied to taxonomic research?, Biological Journal of the Linnean Society, vol.90, issue.4, pp.761-764, 2007.

, Overcoming barriers: the climbing ability and distribution of three species of diadromous shrimp (A. pilipes, C. weberi, and Macrobrachium spp, C. A, 2013.

F. Moorea and . Polynesia, Biology and Geomorphology of Tropical islands, issue.11p

C. Feldman, Distribution and ecology of freshwater shrimp (Decapoda) in the Opunohu River, Biology and Geomorphology of Tropical Islands, vol.5, pp.151-162, 1996.

B. E. Felgenhauer and L. G. Abele, Feeding structures of two atyid shrimps, with comments on caridean phylogeny, Journal of Crustacean Biology, vol.5, issue.3, pp.397-419, 1985.

J. Felsenstein, Confidence limits on phylogenies: an approach using the bootstrap, Evolution, vol.39, issue.4, pp.783-791, 1985.

O. Folmer, M. Black, W. Hoeh, R. Lutz, and R. Vrijenhoek, DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates, Molecular Marine Biology and Biotechnology, vol.3, issue.5, pp.294-299, 1994.

O. Fossati and G. Marquet, Faune des eaux douces des îles Marquises: clé des macroinvertébrés et des poissons, 1998.

O. Fossati, M. Mosseron, and P. Keith, Distribution and habitat utilization in two atyid shrimps (Crustaceae: Decapoda) in rivers of Nuka--Hiva Island (FrenchPolynesia), 2002.

, Hydrobiologia, pp.197-206

,

G. Fryer, The Feeding Mechanism of Some Atyid Prawns of the Genus Caridina, Earth and Environmental Science Transactions of The Royal Society of Edinburgh, vol.64, issue.10, pp.217-244, 1960.

G. Fryer, Studies on the functional morphology and ecology of the atyid prawns of Dominica, Philosophical Transactions of the Royal Society of London. B. Biological Sciences, vol.277, pp.57-129, 1977.

G. Fryer, Evolution in ancient lakes: radiation of Tanganyikan atyid prawns and speciation of pelagic cichlid fishes in Lake Malawi, Hydrobiologia, vol.568, issue.1, pp.131-142, 2006.

T. Fujino and S. Shokita, Report on some new atyid shrimps (Crustacea, Decapoda, Caridea) from the Rykyu Islands, Bulletin of the Sciences and Engineering Division, vol.18, pp.93-113, 1975.

J. Fujita, K. Zenimoto, A. Iguchi, Y. Kai, M. Ueno et al., Comparative phylogeography to test for predictions of marine larval dispersal in three amphidromous shrimps, Marine Ecology Progress Series, vol.560, pp.105-120, 2016.

H. Gauthier, Recherches sur le développement larvaire d'Atyaephyra desmaresti (Millet, 1832), Afrique du Nord, vol.15, pp.337-376, 1924.

J. P. Glaister, Postembryonic growth and development of Caridina nilotica aruensis Roux (Decapoda: Atyidae) reared in the laboratory, Marine and Freshwater Research, vol.27, issue.2, pp.263-278, 1976.

J. I. Goldstein, D. E. Newbury, P. Echlin, D. C. Joy, C. Fiori et al., Scanning Electron Microscopy and X-Ray Microanalysis, 1981.

,

C. Gosset, P. Lamarque, and N. Charlon, Un nouvel appareil de pêche électrique portable, Bulletin Français de Pisciculture, vol.242, pp.33-46, 1971.

K. P. Goudswaard, F. Witte, and J. H. Wanink, The shrimp Caridina nilotica in Lake Victoria (East Africa), before and after the Nile perch increase, Hydrobiologia, vol.563, pp.31-44, 2006.

P. Grandcolas, J. Murienne, T. Robillard, L. Desutter--grandcolas, H. Jourdan et al., New Caledonia: a very old Darwinian island?, Philosophical Transactions of the Royal Society B: Biological Sciences, vol.363, p.3309, 1508.

W. A. Grant and B. W. Bowen, Shallow population histories in deep evolutionary lineages of marine fishes: insights from sardines and anchovies and lessons for conservation, Journal of Heredity, vol.89, issue.5, pp.415-426, 1998.

,

P. Greenaway, Calcium Balance and Moulting in the Crustacea, Biological Reviews, vol.60, issue.3, pp.425-454, 1985.

D. R. Gröcke and D. P. Gillikin, Advances in mollusc sclerochronology and sclerochemistry: tools for understanding climate and environment. Geo-Marine Letters, vol.28, pp.265-268, 2008.

F. E. Guérin--méneville and . Crustacés, Voyage autour du monde, exécuté par ordre du Roi, sur la corvette de Sa Majesté, Arachnides et Insectes. In: Duperrey L.J, pp.1-21

F. E. Guérin--méneville, Animaux articulés à pieds articulés, Histoire physique, 1857.

S. Guindon and O. Gascuel, A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood, Systematic Biology, vol.52, issue.5, pp.696-704, 2003.

A. R. Gurney, Freshwater shrimp genera Caridina and Parisia (Decapoda: Caridea: Atyidae) of Madagascar, with descriptions of four new species, Journal of Natural History, vol.18, issue.4, pp.567-590, 1984.

A. R. Gurney, Puteonator iraqiensis gen. nov., sp. nov., a new genus in the family Atyidae (Decapoda, Caridea) from southern Iraq, Crustaceana, vol.53, issue.2, pp.160-169, 1987.

R. Gurney, Report on the larvae of the Crustacea Decapoda. The Transactions of the Zoological Society of London, vol.22, pp.231-286, 1927.

C. C. Han, C. S. Chang, I. M. Cheng, L. S. Fang, and K. S. Tew, Population dynamics of a landlock and amphidromous freshwater shrimp, Caridina gracilipes (Decapoda: Caridea) in subtropical waters, Journal of Crustacean Biology, vol.31, issue.2, pp.278-285, 2011.

M. A. Hancock, The relationship between egg size and embryonic and larval development in the freshwater shrimp Paratya australiensis Kemp (Decapoda: Atyidae), Freshwater Biology, vol.39, issue.4, pp.715-723, 1998.

G. Hardin, The Competitive Exclusion Principle, Science, vol.131, issue.3409, pp.1292-1297, 1960.

J. A. Hare and R. K. Cowen, Transport mechanisms of larval and pelagic juvenile bluefish (Pomatomus saltatrix) from South Atlantic Bight spawning grounds to Middle Atlantic Bight nursery habitats, Limnology and Oceanography, vol.41, issue.6, pp.1264-1280, 1996.

C. W. Hart, Jonga, a new genus of freshwater atyid shrimps (Decapoda, Atyidae). Notulae Naturae, vol.342, pp.1-3, 1961.

W. P. Hay, Observations on the crustacean fauna of the region about Mammoth Cave, Kentucky, Proceedings of the United States National Museum, vol.25, pp.223-236, 1902.

K. Hayashi and T. Hamano, The Complete Larval Development of Caridina japonica De Man (Decapoda, Caridea, Atyidae) Reared in the Laboratory, Zoological Science, vol.1, issue.4, pp.571-589, 1984.

A. Haynes, An evaluation of members of the genera Clithon Montfort, 1810 and Neritina Lamarck 1816 (Gastropoda: Neritidae), Molluscan Research, vol.25, issue.2, pp.75-84, 2005.

T. C. Heerbrandt and J. Lin, Larviculture of Red Front Shrimp, Caridina gracilirostris (Atyidae, Decapoda), Journal of the World Aquaculture Society, vol.37, issue.2, pp.186-190, 2006.

W. Hennig, Phylogenetic systematics, 1966.

S. J. Hickson, On a new species of the genus Atya (A. Wyckii) from Celebes. The Annals and Magazine of Natural History, vol.6, pp.357-362, 1888.

,

S. Hild, F. Neues, N. ?nidar?i?, J. ?trus, M. Epple et al., Ultrastructure and mineral distribution in the tergal cuticle of the terrestrial isopod Titanethes albus. Adaptations to a karst cave biotope, Journal of Structural Biology, vol.168, issue.3, pp.426-436, 2009.

F. Hilgendorf, Die von Herrn W. Peters in Moçambique gesammelten Crustaceen, bearbeitet von Herrn Dr, vol.1878, pp.782-851, 1878.

D. M. Hillis, Inferring complex phylogenies, Nature, vol.383, pp.130-131, 1996.

D. D. Hinsinger, R. Debruyne, M. Thomas, G. P. Denys, M. Mennesson et al., Fishing for barcodes in the Torrent: from COI to complete mitogenomes on NGS platforms, DNA Barcodes, vol.2015, issue.3, pp.170-186, 2015.
URL : https://hal.archives-ouvertes.fr/mnhn-02309917

C. A. Hipsley and J. Müller, Beyond fossil calibrations: realities of molecular clock practices in evolutionary biology, Frontiers in Genetics, vol.5, issue.138, 2014.

,

S. J. Holmes, Synopsis of California stalk--eyed Crustacea. Occasional papers of the California Academy of Sciences, vol.7, pp.1-262, 1900.

L. B. Holthuis, On a collection of decapod Crustacea from the Republic of El Salvador (central America), Zoologische Verhandelingen, vol.23, pp.1-43, 1954.

L. B. Holthuis, An enumeration of the Crustacea Decapoda Natantia inhabiting subterranean waters, Vie et Milieu, vol.7, issue.1, pp.43-76, 1956.

L. B. Holthuis, Two new species of atyid shrimps from subterranean waters of N.W. Australia (Decapoda Natantia), Crustaceana, vol.1, issue.1, pp.47-57, 1960.

L. B. Holthuis, Two new species of freshwater shrimp (Crustacea Decapoda) from the West Indies, Proceedings van de Koninklijke Nederlandsche Akademie van Wetenschappen (C), vol.66, pp.61-69, 1963.

L. B. Holthuis, The Atyidae of Madagascar, Mémoires du Muséum National d'Histoire Naturelle, séries A (Zoologie), vol.33, pp.1-48, 1965.

L. B. Holthuis, Etudes hydrobiologiques en Nouvelle--Calédonie (Mission 1965 du Premier institut de Zoologie de l'Université de Vienne). IX. The freshwater shrimps of New Caledonia, vol.3, pp.87-108, 1969.

L. B. Holthuis, A collection of Decapod Crustacea from Sumba, Lesser Sunda islands, Indonesia. Zoologische Verhandelingen, vol.162, pp.1-55, 1978.

L. B. Holthuis, Zoological results of the British speleological expedition to Papua New Guinea 1975. 7. Cavernicolous shrimps (Crustacea Decapoda, Natantia) from New Ireland and the Philippines, Zoologische Mededelingen, vol.53, issue.19, pp.209-224, 1978.

L. B. Holthuis, FAO species catalogue. Volume 1-Shrimps and prawns of the world (An annotated catalogue of species of interest to fisheries, vol.1, 1980.

L. B. Holthuis, Freshwater Crustacea Decapoda of New Guinea, pp.603-619, 1982.

L. B. Holthuis, A new genus and species of subterranean shrimp from Western Australia (Crustacea: Decapoda: Atyidae), Zoologische Mededelingen, vol.60, pp.103-111, 1986.

L. B. Holthuis, The recent genera of the Caridean and Stenopodidean shrimps (Crustacea, Decapoda) with an appendix on the order Amphionidacea, Nationaal Natuurhistorisch Museum, vol.328, 1993.

J. P. Huelsenbeck and F. Ronquist, MrBayes: a program for the Bayesian inference of phylogeny, Bioinformatics, vol.17, pp.754-755, 2001.

N. F. Hughes, Nile perch, Lates niloticus, predation on the freshwater prawn, Caridina nilotica, Environmental Biology of Fishes, vol.33, issue.3, pp.307-309, 1992.

M. Hung, T. Chan, and H. P. Yu, Atyid shrimps (Decapoda: Caridea) of Taiwan, with descriptions of three new species, Journal of Crustacean Biology, vol.13, issue.3, pp.481-503, 1993.

W. Hunte, The distribution of freshwater shrimps (Atyidae and Palaemonidae) in Jamaica, Zoological Journal of the Linnean Society, vol.64, issue.2, pp.135-150, 1978.

W. Hunte, The Complete Larval Development of the Freshwater Shrimp Atya innocous (Herbst) Reared in the Laboratory (Decapoda, Atyidae), Crustaceana Supplement, vol.5, pp.231-242, 1979.

W. Hunte, The Complete Larval Development of the Freshwater Shrimp Micratya poeyi (Guérin--Méneville) Reared in the Laboratory (Decapoda, Atyidae), 1979.

, Crustaceana Supplement, vol.5, pp.153-166

D. A. Hurwood and J. M. Hughes, Nested clade analysis of the freshwater shrimp, Caridina zebra (Decapoda: Atyidae), from northeastern Australia, Molecular Ecology, vol.10, issue.1, pp.113-125, 2001.

G. E. Hutchinson, Population Biology and Evolution, pp.177-186, 1968.

T. H. Huxley, On the classification and distribution of the Alectoromorphae and Heteromorphae, Proceedings of the Zoological Society of London, vol.1868, pp.294-319, 1868.

A. Ito, Y. Fujita, and S. Shokita, Larval stages of Macrobrachium australe (Guérin Méneville, 1838)(Decapoda: Palaemonidae), described from laboratory--reared material, Crustacean Research, vol.31, pp.47-72, 2002.

D. R. Jalihal and S. Shenoy, Taxonomic revision of some Indian prawn species of genus Caridina H, Proceedings and abstracts of the fourth international crustacean congress, pp.128-129, 1998.

D. R. Jalihal, S. Shenoy, and K. N. Sankolli, Five new species of freshwater atyid shrimps of the genus Caridina H. Milne Edwards from Dharwar area (Karnataka State, India). Records of the Zoological Survey of India, Occasional Paper, vol.69, pp.1-40, 1984.

D. S. Johnson, Distributional and other notes on some freshwater prawns (Atyidae and Palaemonidae) mainly from the Indo--West Pacific region, Bulletin of the National Museum of Singapore, vol.32, pp.5-30, 1963.

N. Joly, Etude sur les moeurs, le développement et les métamorphoses d'une salicoque d'eau douce (Caridina Desmarestii), Annales des Sciences Naturelles: Zoologie et Biologie Animale, vol.19, pp.34-86, 1843.

J. Jugovic, S. Prevorcnik, G. Aljancic, and B. Sket, The atyid shrimp (Crystacea: Decapoda: Atyidae) rostrum: phylogeny versus adaptation, taxonomy versus trophic ecology, Journal of Natural History, vol.44, pp.2509-2533, 2010.

J. Jurado--rivera, J. Pons, F. Alvarez, A. Botello, W. F. Humphreys et al., Phylogenetic evidence that both ancient vicariance and dispersal have contributed to the biogeographic patterns of anchialine cave shrimps, Scientific Reports, vol.7, p.2852, 2017.

A. Karge and W. Klotz, Süßwassergarnelen aus aller Welt, 2007.

A. Karge, ). Rintelen-(von, K. Klotz, and W. , On two small collections of freshwater shrimps (Decapoda: Atyidae: Caridina) from Papua New Guinea, with descriptions of two new species, Zootaxa, vol.2372, pp.138-150, 2010.

M. Kearse, R. Moir, A. Wilson, S. Stones--havas, M. Cheung et al., Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data, Bioinformatics, vol.28, issue.12, pp.1647-1649, 2012.

P. Keith, P. Gerbeaux, G. Marquet, L. Taillebois, and M. Castelin, Freshwater survey of Babeldaob (Palau), Muséum national d'Histoire naturelle, pp.1-32, 2011.

P. Keith, P. Gerbeaux, G. Marquet, L. Taillebois, and M. Castelin, Freshwater survey of Pohnpei, Muséum national d'Histoire naturelle, p.27, 2012.

P. Keith, C. Lord, and K. Maeda, Indo-Pacific Sicydiine Gobies: biodiversity, life traits and conservation. Société Française d'Ichtyologie, 2015.

P. Keith and G. Marquet, Poissons et crustacés d'eau douce de Wallis et Futuna, 2011.

P. Keith, G. Marquet, P. Gerbeaux, E. Vigneux, and C. Lord, Poissons et crustacés d'eau douce de Polynésie. Société Française d'Ichtyologie, 2013.

P. Keith, G. Marquet, C. Lord, D. Kalfatak, and E. Vigneux, Vanuatu freshwater fish and crustaceans. Société Française d'Ichtyologie, 2010.

P. Keith, G. Marquet, P. Valade, P. Bosc, and E. Vigneux, Atlas des poissons et des crustacés d'eau douce des Comores, Mascareignes et Seychelles (Collection Patrimoines naturels, vol.65, 2006.

P. Keith and E. Vigneux, Revue des crustacés Atyidae et Palaemonidae d'eau douce de Polynésie française avec description d'une nouvelle espèce de Macrobrachium. Bulletin Français de la Pêche et de la Pisciculture, vol.364, pp.121-145, 2002.

P. Keith, E. Vigneux, and P. Bosc, Atlas des poissons et des crustaces d'eau douce de la Réunion, Collection Patrimoines Naturels, vol.39, issue.136p, 1999.

P. Keith, E. Vigneux, and G. Marquet, Atlas des poissons et des crustacés d'eau douce de la Polynésie française, vol.55, 2002.

S. Kemp, Zoological results of a tour in the Far East, Crustacea Decapoda and Stomatopoda. Memoirs of the Asiatic Society of Bengal, vol.6, pp.218-297, 1918.

R. Kilada and E. Acuna, Direct age determination by growth band counts of three commercially important crustacean species in Chile, Fisheries Research, vol.170, pp.134-143, 2015.

R. Kilada, A. L. Agnalt, N. Hammeken-arboe, S. Bjarnason, A. Burmeister et al., Feasability of using growth band counts in age determination of four crustacean species in the northern Atlantic, Journal of Crustacean Biology, vol.35, issue.4, pp.499-503, 2015.

R. Kilada and J. G. Driscoll, Age determination in crustaceans: a review, Hydrobiologia, vol.799, issue.1, pp.21-36, 2017.

R. Kilada and N. K. Ibrahim, Preliminary investigation of direct age determination using band counts in the gastric mill of the blue swimmer crab (Portunus pelagicus Linnaeus, 1758) in two salt--water lakes in the eastern Mediterranean, Journal of Crustacean Biology, vol.36, pp.119-128, 2016.

R. Kilada, B. Sainte--marie, R. Rochette, N. Davis, C. Vanier et al., Direct determination of age in shrimps, crabs and lobsters, Canadian Journal of Fisheries and Aquatic Sciences, vol.69, pp.1728-1733, 2012.

J. S. Kingsley, On a Collection of Crustacea from Virginia, North Carolina, and Florida, with a Revision of the Genera of Crangonidae and Palaemonidae, Proceedings of the Academy of Natural Sciences of Philadelphia, vol.31, issue.3, pp.383-427, 1879.

J. S. Kingsley, 1883) Carcinological Notes; Number V, Bulletin of the Essex Institute, vol.14, pp.105-132

W. Klotz and S. De-grave, Elephantis jaggeri, a replacement name for Elephantis natalensis (Bouvier, 1925), a junior primary homonym of Caridina nilotica var, Crustaceana, vol.88, pp.1463-1465, 1908.

W. Klotz, A. Karge, ). Rintelen-(von, and K. , A redescription of two atyid shrimps (Decapoda: Caridina) from Central Sulawesi, Indonesia. Zootaxa, vol.1466, issue.1, pp.1-10, 2007.

W. Klotz, ). Rintelen-(von, and K. , Three new species of Caridina (Decapoda: Atyidae) from Central Sulawesi and Buton Island, Indonesia, and a checklist of the islands' endemic species, 2013.

, Zootaxa, vol.3664, issue.4, pp.554-570

,

W. Klotz, ). Rintelen-(von, and T. , To "bee" or not to be --on some ornamental shrimp from Guangdong Province, Southern China and Hong Kong SAR, with descriptions of three new species, Zootaxa, vol.3889, issue.2, pp.151-184, 2014.

,

N. Knowlton, L. A. Weigt, L. A. Solorzano, D. K. Mills, and E. Bermingham, Divergence in proteins, mitochondrial DNA, and reproductive compatibility across the isthmus of Panama, Science, vol.260, pp.1629-1632, 1993.

K. Kobayashi, E. Koji, O. V. Noah-ewoti, F. M. Onana, S. Tchakonté et al., Influence of Anthropogenic Pollution on the Abundance Dynamics of Some Freshwater Invertebrates in the Coastal Area of Cameroon, Journal of Environmental Protection, vol.157, pp.810-829, 2004.

K. M. Konan, A. B. Adépo--gourène, A. Ouattara, W. D. Nyingy, and G. Gourène, Morphometric variation among male populations of freshwater shrimp Macrobrachium vollenhovenii Herklots, 1851 from Côte d'Ivoire Rivers, Fisheries Research, vol.103, issue.1--3, pp.1-8, 2010.

I. Kubo, On the Japanese atyid shrimps, Journal of the Imperial Fisheries Institute, vol.33, pp.67-100, 1938.

A. Kumar, H. Doan, M. Barnes, J. C. Chapman, and R. S. Kookana, Response and recovery of acetylcholinesterase activity in freshwater shrimp, Paratya australiensis (Decapoda: Atyidae) exposed to selected anti--cholinesterase insecticides, Ecotoxicology and Environmental Safety, vol.73, issue.7, pp.1503-1510, 2010.

A. Kumar, C. Grocke, S. Bajet, and C. , Toxicity of selected pesticides to freshwater shrimp, Paratya australiensis (Decapoda: Atyidae): Use of time series acute toxicity data to predict chronic lethality, Ecotoxicology and Environmental Safety, vol.73, issue.3, pp.360-369, 2010.

S. Kumar, G. Stecher, and K. Tamura, MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets, Molecular Biology and Evolution, vol.33, issue.7, pp.1870-1874, 2016.

H. Lai and J. Shy, The larval development of Caridina pseudodenticulata (Crustacea: Decapoda: Atyidae) reared in the laboratory, with a discussion of larval metamorphosis types. The Raffles Bulletin of Zoology, vol.20, pp.97-107, 2009.

S. Lakshmi, On the early larval development of Caridina sp. (Crustacea, Decapoda, Atyidae), Indian Journal of Fisheries, vol.22, issue.1, pp.68-79, 1975.

P. Lamarque, Etude des conditions de la pêche à l'électricité dans les eaux tropicales, Recherche Scientifique de Biarritz, vol.10, issue.3, pp.403-554, 1975.

R. Lanfear, B. Calcott, S. Y. Ho, and S. Guindon, PartitionFinder: combined selection of partitioning schemes and substitution models for phylogenetic analyses, Molecular Biology and Evolution, vol.29, issue.6, pp.1695-1701, 2012.
URL : https://hal.archives-ouvertes.fr/lirmm-00705211

P. R. Last, W. T. White, W. T. White, D. C. Gledhill, J. J. Pogonoski et al., Biogeographical structure and affinities of the marine demersal ichtyofauna of Australia, Journal of Fish Biology, vol.79, issue.5, pp.1484-1496, 2011.

,

P. A. Latreille, 1802) Histoire naturelle, générale et particulière des, Crustacés et des Insectes, vol.3, issue.476p

W. E. Leach, 1816) Atya. In: Encyclopedia Brittanica, supplement to the fourth, fifth and sixth editions, p.421

T. Leberer and Y. Cai, Shrimps of the family Atyidae from Guam, Mariana Islands. Micronesica, pp.353-358, 2003.

T. Leberer and S. G. Nelson, Factors affecting the distribution of atyid shrimps in two tropical insular rivers, vol.55, pp.389-398, 2001.

C. L. Lee and D. R. Fielder, The effect of salinity and temperature on the larval development of the freshwater prawn Macrobrachium australiense Holthuis, 1950 from south eastern Queensland, Australia. Aquaculture, vol.26, pp.90120-90124, 1981.

J. C. Leland, J. Coughran, and D. J. Bucher, A preliminary investigation into the potential value of gastric mills for ageing crustaceans, New Frontiers in Crustacean Biology, Proceedings of the TCS Summer Meeting, pp.57-68, 2009.

H. Lenz, Crustaceen von Madagaskar, Ostafrika und Ceylon, Reise in Ostafrika in den Jahren 1903-1905 mit Mitteln der Hermann und Elise geb. Heckmann Wentzel--Stiftung ausgeführt, pp.539-576, 1910.

H. Lenz, Afrikanische Crustaceen aus schwedischen sammlungen, Arkiv für Zoologi, vol.7, issue.29, pp.1-10, 1912.

H. A. Lessios, B. D. Kessing, D. R. Robertson, and G. Paulay, Phylogeography of the pantropical sea urchin Eucidaris in relation to land barriers and ocean currents, Evolution, vol.53, issue.3, pp.806-817, 1999.

S. Li and X. Liang, Caridean prawns of northern Vietnam (Decapoda: Atyidae, Palaemonidae), Acta Zootaxonomica Sinica, vol.27, pp.707-716, 2002.

X. Liang, Fauna Sinica. Invertebrata, vol.36, issue.375p, 2004.

X. Liang and Y. Cai, Sinodina, a new genus of freshwater shrimps (Crustacea: Decapoda: Atyidae) from southern China, with descriptions of three new species, Raffles Bulletin of Zoology, vol.47, issue.2, pp.577-590, 1999.

X. Liang, Z. Guo, and K. Tang, On new genus and species of atyid shrimps (Decapoda, Caridea) from Hunan, China. Journal of Fisheries of China, vol.23, pp.69-73, 1999.

X. Liang and S. Yan, New species and subspecies of Caridina (Decapoda, Caridea) from Fukien, China, Acta Hydrobiologia Sinica, vol.6, pp.219-225, 1977.

X. Liang and S. Yan, A new genus and two new species of freshwater prawns (Crustacea Decapoda) from Guangxi, China, Acta Zootaxonomica Sinica, vol.6, pp.31-35, 1981.

M. A. Linant-de-bellefonds, Mémoire sur le Lac Moéris, présenté et lu à la Société Egyptienne le 5 juillet 1842, Société Egyptienne, 1843.

D. T. Littlewood, Molecular phylogenetics of cupped oysters based on partial 28S rRNA gene sequences, Molecular Phylogenetics and Evolution, vol.3, issue.3, pp.221-229, 1994.

A. R. Longhurst, U. Lord, C. Lorion, J. Dettai, A. Watanabe et al., From endemism to widespread distribution: phylogeography of three amphidromous Sicyopterus species (Teleostei: Gobioidei: Sicydiinae), Marine Ecology Progress Series, vol.455, pp.269-285, 1998.

C. M. Lorion, B. P. Kennedy, and J. H. Braatne, Altitudinal gradients in stream fish diversity and the prevalence of diadromy in the Sixaola River basin, Costa Rica. Environmental Biology of Fishes, vol.91, issue.4, pp.487-499, 2011.

V. Lukoschek, J. Scott-keogh, and J. C. Avise, Evaluating fossil calibrations for dating phylogenies in light of rates of molecular evolution: a comparison of three approaches, Systematic Biology, vol.61, issue.1, pp.22-43, 2012.

,

R. Lydekker, 1896) A geographical history of mammals (Cambridge geographical series). The University press

J. A. Maciolek and J. I. Ford, Macrofauna and environment of the Nanpil--Kiepw River, Bulletin of Marine Science, vol.41, issue.2, pp.623-632, 1987.

W. P. Maddison and D. R. Maddison, Mesquite: a modular system for evolutionary analysis, 2018.

J. Mallet, A species definition for the modern synthesis, Trends in Ecology & Evolution, vol.10, issue.7, pp.90031-90035, 1995.

J. G. March, J. P. Benstead, C. M. Pringle, M. ;. Luckymis, J. P. Benstead et al., Benthic Community Structure and Invertebrate Drift in a Pacific Island Stream, Kosrae, Micronesia, Biotropica, vol.35, issue.1, pp.1069-1078, 2003.

J. G. March and C. M. Pringle, Food Web Structure and Basal Resource Utilization along a Tropical Island Stream Continuum, Biotropica, vol.35, issue.1, pp.84-93, 2003.

G. Marquet, Les eaux intérieures de la Polynésie française. Principales caractéristiques physiques, chimiques et biologiques, p.233, 1988.

G. Marquet, Freshwater crustaceans of French Polynesia: Taxonomy, distribution and biomass (Decapoda), Crustaceana, issue.2, pp.125-140, 1991.

,

G. Marquet, P. Keith, and D. Kalfatak, Caridina gueryi, a new species of freshwater shrimp (Decapoda, Atyidae) from Santo island, Crustaceana, vol.82, issue.2, pp.159-166, 2009.
URL : https://hal.archives-ouvertes.fr/hal-00440328

G. Marquet, P. Keith, and E. Vigneux, Atlas des poissons et des crustacés d'eau douce de Nouvelle-Calédonie, Collection Patrimoines naturels, vol.58, issue.288p, 2003.

). Martens-;-von and E. , Über Cubanische Crustaceen nach den Sammlungen Dr, J. Gundlach's. Archiv für Naturgeschichte, vol.38, pp.77-147, 1872.

E. Martinez, A. Ganachaud, J. Lefevre, and K. Maamaatuaiahutapu, Central South Pacific thermocline water circulation from a high--resolution ocean model validated against satellite data: Seasonal variability and El Niño 1997-1998 influence, Journal of Geophysical Research, vol.114, issue.C5012, pp.1-16, 2009.

J. Matja?ic, Ein neuer Höhlendecapode aus Jugoslawien, Zoologischer Anzeiger, vol.157, pp.65-68, 1956.

R. L. Mayden, A hierarchy of species concepts: The denouement in the saga of the species problem, pp.381-424, 1997.

E. Mayr, Systematics and the origin of species from the viewpoint of a zoologist, 1942.

V. Mazancourt-;-de), G. Marquet, and P. Keith, The "Pinocchio shrimp effect": First evidence of rostrum length variation with the Environment in Caridina (Crustacea: Decapoda: Atyidae), Journal of Crustacean Biology, vol.37, issue.3, pp.249-257, 2017.

V. Mazancourt-;-de), G. Marquet, and P. Keith, Caridina variabilirostris (Crustacea: Decapoda: Atyidae), a new species of freshwater shrimp from Pohnpei (Micronesia), European Journal of Taxonomy, vol.453, pp.1-16, 2018.
URL : https://hal.archives-ouvertes.fr/hal-02171169

,

V. Mazancourt-;-de), G. Marquet, W. Klotz, P. Keith, and M. Castelin, When morphology and molecules work together: lines of evidence for the validity of Caridina buehleri Roux, 1934 (Crustacea: Decapoda: Atyidae) and Caridina gueryi Marquet, Keith & Kalfatak, 2009 as its junior synonym, Invertebrate Systematics, vol.31, pp.220-230, 2017.

V. Mazancourt-;-de), G. Marquet, D. C. Rogers, and P. Keith, Description of a new species of Caridina (Crustacea: Decapoda: Atyidae) from two Micronesian islands (Guam and Babeldaob), Zootaxa, vol.4377, issue.1, pp.39-50, 2018.

,

R. Mcdowall, On amphidromy, a distinct form of diadromy in aquatic organisms, Fish and Fisheries, vol.8, issue.1, pp.1-13, 2007.

M. Mennesson, Taxonomie, Phylogénie et Dispersion du genre Eleotris (Teleostei : Gobioidei : Eleotridae) dans l'Indo--Pacifique. In. Muséum national d'Histoire naturelle, 2016.

M. Mennesson, C. Bonillo, E. Feunteun, and P. Keith, Phylogeography of Eleotris fusca (Teleostei: Gobioidei: Eleotridae) in the Indo--Pacific area reveals a cryptic species in the Indian Ocean, pp.1-14, 2018.
URL : https://hal.archives-ouvertes.fr/hal-01957194

,

M. Mennesson and P. Keith, Evidence of two species currently under the name Eleotris fusca (Gobioidei: Eleotridae) in the Indian Ocean, Cybium, vol.41, issue.2, pp.213-220, 2017.

P. K. Mensah, W. J. Muller, and C. G. Palmer, Acute toxicity of Roundup® herbicide to three life stages of the freshwater shrimp Caridina nilotica (Decapoda: Atyidae), vol.36, pp.905-909, 2011.

F. J. Meunier and G. Boivin, Action de la fluorescéine, de l'alizarine, du bleu de calcéine et de diverses doses de tétracycline sur la croissance de la truite et de la carpe, Annales de biologie animale, vol.18, issue.6, pp.1293-1308, 1978.

C. D. Michener, Diverse approaches to systematics, Evolutionary Biology, vol.4, pp.1-38, 1970.

E. J. Miers, Note on a freshwater Macrurous Crustacean from Japan (Atyephyra? compressa, De Haan?), Natural History, Series, vol.5, issue.51, pp.193-195, 1882.

M. A. Miller, W. Pfeiffer, and T. Schwartz, Creating the CIPRES Science Gateway for inference of large phylogenetic trees, Proceedings of the Gateway Computing Environments Workshop (GCE), pp.1-8, 2010.

A. Milne-edwards, 1879) Description d'un Crustacé fossile provenant des marnes d'Aix en Provence (Caridina nitida), vol.7, pp.77-78

H. Milne-edwards, Histoire Naturelle des Crustacés, Comprenant l´Anatomie, la Physiologie et la Classification de ces Animaux, vol.II, 1837.

K. Mizue and Y. Iwamoto, On the development and growth of Neocaridina denticulata De Haan. Bulletin of the Faculty of Fisheries, vol.10, pp.15-24, 1961.

T. Monod and P. Cals, Sur une espèce nouvelle de crevette cavernicole: Typhlatya galapagensis (Decapoda Natantia, 1970.

. Atyidae, Mission Zoologique Belge aux îles Galapagos et en Ecuador (N. et J. Leleup, vol.2, pp.57-103, 1964.

P. , Conchyliologie systématique et classification méthodique des coquilles, vol.2, 1810.

R. D. Müller, J. Y. Royer, and L. A. Lawyer, Revised plate motions relative to the hotspots from combined Atlantic and Indian Ocean hotspot tracks, Geology, vol.21, issue.3, pp.275-278, 1993.

. Multilatéral, Convention des Nations Unies dur le droit de la mer (avec annexes, acte final en date des 3 mars 1986 et 26 juillet 1993). Conclue à Montego Bay le 10 décembre 1982, Nations Unies, 1994.

G. S. Myers, Usage of anadromous, catadromous and allied terms for migratory fishes, Copeia, vol.1949, issue.2, pp.89-97, 1949.

H. Nagasawa, The crustacean cuticle: structure, composition and mineralization, Frontiers in Biosciences, vol.4, pp.711-720, 2012.

K. B. Nair, The embryology of Caridina laevis Heller, Proceedings of the Indian Academy of Sciences -Section B, vol.29, issue.6, pp.211-288, 1949.

Y. Nakahara, A. Hagiwara, Y. Sanya, and K. Hirayama, Larval rearing of three amphidromous shrimp species (Atyidae) under different feeding and salinity conditions, Aquaculture Science, vol.53, issue.3, pp.305-310, 2005.

,

S. G. Nelson, F. A. Camacho, J. E. Parham, R. B. Tibbats, T. Leberer et al., Surveys of the macrofauna of the Nanpil Kiepw and Lehn Mesi rivers of Pohnpei, 1966.

P. K. Ng, Collecting and processing freshwater shrimps and crabs, Journal of Crustacean Biology, vol.37, issue.1, pp.115-122, 2017.

G. Nobili, Decapodi e isopodi della Nuova Guinea Tedesca raccolti dal, Sign. L. Biró. Annales Historico-Naturales Musei Nationalis Hungarici, vol.3, pp.480-507, 1905.

M. E. Ocasio--torres, T. A. Crowl, and A. M. Sabat, Long rostrum in an amphidromous shrimp induces by chemical signals from a predatory fish, Freshwater Science, vol.33, pp.451-458, 2014.

M. E. Ocasio--torres, T. Giray, T. A. Crowl, and A. M. Sabat, Antipredator defence mechanism in the amphidromous shrimp Xiphocaris elongata (Decapoda: Xiphocarididae): rostrum length, Journal of Natural History, vol.49, pp.1493-1506, 2015.

D. M. Olson, E. Dinerstein, E. D. Wikramanayake, N. D. Burgess, G. V. Powell et al., Terrestrial ecoregions of the world: a new map of life on Earth, BioScience, vol.51, issue.11, p.51, 2001.

A. Ortmann, 1894) A study of the systematic and geographical distribution of the decapod family Atyidae Kingsley, Proceedings of the Academy of Natural Sciences of Philadelphia, vol.46, pp.397-416

J. M. Padial, S. Castroviejo--fisher, J. Köhler, C. Vilà, J. C. Chaparro et al., Deciphering the products of evolution at the species level: the need for an integrative taxonomy, Zoologica Scripta, vol.38, issue.4, pp.431-447, 2009.

,

J. M. Padial, A. Miralles, I. De-la-riva, and M. Vences, The integrative future of taxonomy, Frontiers in Zoology, vol.7, pp.1-16, 2010.

T. J. Page, S. C. Choy, and J. M. Hughes, The Taxonomic Feedback Loop: symbiosis of morphology & molecules, Biology Letters, vol.1, pp.139-142, 2005.

,

T. J. Page, B. D. Cook, ). Rintelen-(von, T. ;. , K. Hughes et al., Evolutionary relationships of atyid shrimps imply both ancient Caribbean radiations and common marine dispersals, Journal of the North American Benthological Society, vol.27, issue.1, pp.68-83, 2008.

T. J. Page and J. M. Hughes, Radically different scales of phylogeographic structuring within cryptic species of freshwater shrimp (Atyidae: Caridina), Limnology and Oceanography, pp.1055-1066, 2007.

,

T. J. Page and J. M. Hughes, Neither molecular nor morphological data have all the answers; with an example from Macrobrachium (Decapoda: Palaemonidae) from Australia, Zootaxa, vol.2874, pp.65-68, 2011.

T. J. Page, ). Rintelen-(von, K. Hughes, and J. M. , An island in the stream: Australia's place in the cosmopolitan world of Indo--West Pacific freshwater shrimp (Decapoda: Atyidae: Caridina), Molecular Phylogenetics and Evolution, vol.43, issue.2, pp.645-659, 2007.

T. J. Page, ). Rintelen-(von, K. Hughes, and J. M. , Phylogenetic and biogeographic relationships of subterranean and surface genera of Australian Atyidae (Crustacea: Decapoda: Caridea) inferred with mitochondrial DNA, Invertebrate Systematics, vol.21, issue.2, pp.137-145, 2007.

S. R. Palumbi, Nucleic acids II: the polymerase chain reaction, 1996.

, Molecular systematics. Sinauer Associates, pp.205-247

G. Pannella, Fish otoliths: daily growth layers and periodical patterns, Science, vol.173, pp.1124-1127, 1971.

G. Pannella, Otoliths growth patterns: an aid in age determination in temperate and tropical fishes, Unwin Brothers, pp.28-39, 1974.

J. A. Pantaleao, R. A. Gregati, R. C. Da-costa, L. S. Lopez--greco, and M. L. Negreiros--fransozo, Post--hatching development of the ornamental 'Red Cherry Shrimp' Neocaridina davidi (Bouvier, 1904) (Crustacea, Caridea, Atyidae) under laboratorial conditions, Aquaculture Research, vol.48, issue.2, pp.553-569, 2015.

,

E. Pante, N. Puillandre, A. Viricel, S. Arnaud--haond, D. Aurelle et al., Species are hypotheses: avoid connectivity assessments based on pillars of sand, Molecular Ecology, vol.24, issue.3, pp.525-544, 2015.
URL : https://hal.archives-ouvertes.fr/hal-02002440

E. Pante, S. Schoelinck, and N. Puillandre, From Integrative Taxonomy to Species Description: One Step Beyond, Systematic Biology, vol.64, issue.1, pp.152-160, 2015.
URL : https://hal.archives-ouvertes.fr/hal-01076864

G. Paulay, Biodiversity on Oceanic Islands: Its Origin and Extinction, American Zoologist, vol.34, issue.1, pp.134-144, 1994.

-. Pérez, O. Crowl, T. A. Covich, and A. P. , Effects of food supplies and water tempreature on growth rates of two species of freshwater tropical shrimps, Freshwater Biology, vol.60, issue.8, pp.1514-1524, 2015.

N. N. Pillai, Larval development of Caridina pseudogracilirostris reared in the laboratory, Journal of the Marine Biological Association of India, vol.17, issue.2, pp.2-17, 1975.

N. N. Pillai, Larval history of Caridina longirostris H. Milne Edwards, Journal of the Marine Biological Association of India, vol.44, issue.1, pp.59-75, 2002.

A. C. Pires and L. Marinoni, DNA barcoding and traditional taxonomy unified through Integrative Taxonomy: a view that challenges the debate questioning both methodologies, Biota Neotropica, vol.10, issue.2, pp.339-346, 2010.

,

S. Planes, Genetic differentiation in relation to restricted larval dispersal of the convict surgeonfish Acanthurus triostegus in French Polynesia, Marine Ecology Progress Series, vol.98, pp.237-246, 1993.

S. Planes and R. Galzin, New perspectives in biogeography of coral reef fish in the Pacific using phylogeography and population genetic approaches, Vie et Milieu, vol.47, pp.375-380, 1997.

M. Pouilly, S. Barrera, and C. Rosales, Changes of taxonomic structure of fish assemblages along an environmental gradient in the Upper Beni watershed (Bolivia), Journal of Fish Biology, vol.68, issue.1, pp.137-156, 2006.

C. M. Pringle, Atyid shrimps (Decapoda: Atyidae) influence the spatial heterogeneity of algal communities over different scales in tropical montane streams, Puerto Rico. Freshwater Biology, vol.35, issue.1, pp.125-140, 1996.

,

C. M. Pringle, G. A. Blake, A. P. Covich, K. M. Buzby, and A. Finley, Effects of omnivorous shrimp in a montane tropical stream: sediment removal, disturbance of sessile invertebrates and enhancement of understory algal biomass, Oecologia, vol.93, pp.1-11, 1993.

H. Puchtler, S. N. Meloan, and M. S. Terry, On the history and mechanism of alizarin and alizarin red S stains for calcium, The Journal of Histochemistry and Cytochemistry, vol.17, issue.2, pp.110-124, 1969.

A. Purvis, J. L. Gittleman, G. Cowlishaw, and G. M. Mace, Predicting extinction risk in declining species, Proceedings of the Royal Society of London Series B: Biological Sciences, vol.267, pp.1947-1952, 1456.

K. Pütz and F. Buchholz, Comparative ultrastructure of the cuticle of some pelagic, nektobenthic and benthic malacostracan crustaceans, Marine Biology, vol.110, pp.49-58, 1991.

M. Pyron and A. P. Covich, Migration patterns, densities, and growth of Neritina punctulata snails in Rio Espiritu Santo and Rio Mameyes, northeastern Puerto Rico, Caribbean Journal of Science, vol.39, issue.3, pp.338-347, 2003.

D. Raabe, P. Romano, C. Sachs, A. Al--sawalmih, H. Brokmeier et al., Discovery of a honeycomb structure in the twisted plywood patterns of fibrous biological nanocomposite tissue, Journal of Crystal Growth, vol.283, pp.1-7, 2005.

D. Rabadà, Crustaceos decápodos de Las Hoyas (Cuenca) y del Montsec de Rúbies (Lleida), Acta Geologica Hispanica, vol.25, issue.4, pp.299-311, 1990.

D. Rabadà, Crustáceos decápodos lacustres de las calizas litográficas del Cretácico inferior de España: Las Hoyas (Cuenca) y el Montsec de Rúbies (Lleida), 1993.

C. De and G. Ibérica, , vol.17, pp.345-370

R. L. Radtke, R. A. Kinzie, and S. D. Folsom, Age at recruitment of Hawaiian freshwater gobies, Environmental Biology of Fishes, vol.23, issue.3, pp.205-213, 1988.

M. J. Rathbun, Investigations of the Aquatic Resources and Fisheries of Porto Rico by the United States Fish Commission Steamer Fish Hawk in 1899. The Brachyura and Macrura of Porto Rico, Bulletin of the United States Fish Commission, vol.20, pp.1-127, 1901.

S. Ratnasingham and P. D. Hebert, Bold: The Barcode of Life Data System, Molecular Ecology Notes, vol.7, issue.3, pp.355-364, 2007.

R. H. Ree and S. A. Smith, Maximum likelihood inference of geographic range evolution by dispersal, local extinction, and cladogenesis, Systematic Biology, vol.57, issue.1, pp.4-14, 2008.

H. U. Rehman, H. Nakaya, and K. Kawai, Geological Origin of the volcanic islands of the Caroline Group in the Federated States of Micronesia, Western Pacific. South Pacific Studies, vol.33, issue.2, pp.101-118, 2013.

V. H. Resh, J. R. Barnes, and D. A. Craig, Distribution and ecology of benthic macroinvertebrates in the Opunohu river catchment, International Journal of Limnology, vol.26, issue.2--3, pp.195-214, 1990.

,

J. Richard and M. R. Chandran, A systematic report on the fresh water prawns of the atyid genus Caridina H. Milne Edwards 1837, from Madras (Tamilnadu: India), Journal of the Bombay Natural History Society, vol.91, pp.241-259, 1994.

J. Richard and P. F. Clark, Caridina nilotica (P. Roux, 1833) (Crustacea: Decapoda: Caridea: Atyidae) from East Africa, with descriptions of four new species, Proceedings of the Biological Society of Washington, vol.118, pp.706-730, 2005.

J. Richard and P. F. Clark, African Caridina (Crustacea: Decapoda: Caridea: Atyidae): redescriptions of C. africana Kingsley, 1882, C. togoensis Hilgendorf, 1893, C. natalensis Bouvier, 1925 and C. roubaudi Bouvier, 1925 with descriptions of 14 new species, Zootaxa, pp.1-75, 1995.

J. Richard, P. F. Clark, H. M. Caridina, and . Edwards, Crustacea: Decapoda: Caridea: Atyoidea: Atyidae) freshwater shrimps from eastern and southern Africa, vol.2372, pp.305-337, 2010.

J. Richard and P. F. Clark, Crustacea: Decapoda: Caridea: Atyoidea: Atyidae) and the synonymy by Johnson, vol.3841, pp.301-338, 1904.

J. Richard, S. De-grave, and P. F. Clark, A new atyid genus and species from Madagascar (Crustacea: Decapoda: Caridea), Zootaxa, vol.3162, pp.31-38, 2012.

A. G. Richards, The integument of arthropods, 1951.

F. Richters, 1880) Decapoda, Beiträge zur Meeresfauna der Insel Mauritius und der Seychellen

F. Möbius, E. Richters, and . Martens, , pp.115-118

K. Rintelen-;-von) and Y. Cai, Radiation of endemic species flocks in ancient lakes: systematic revision of the freshwater shrimp Caridina H. Milne Edwards, 1837 (Crustacea: Decapoda: Atyidae) from the ancient lakes of Sulawesi, Indonesia, with the description of eight new species, Raffles Bulletin of Zoology, vol.57, pp.343-452, 2009.

). Rintelen-;-von, K. Karge, A. Klotz, and W. , News from a small island --first record of a freshwater shrimp (Decapoda, Atyidae, Caridina) from Peleng, Banggai Islands, Indonesia, Journal of Natural History, vol.42, pp.2243-2256, 2008.

,

). Rintelen-;-von, K. Page, T. J. Cai, Y. Roe, K. Stelbrink et al., Drawn to the dark side: a molecular phylogeny of freshwater shrimps (Crustacea: Decapoda: Caridea: Atyidae) reveals frequent cave invasions and challenges current taxonomic hypotheses, Molecular Phylogenetics and Evolution, vol.63, issue.1, pp.82-96, 2012.

). Rintelen-;-von, K. Rintelen-(von, ). , T. Glaubrecht, and M. , Molecular phylogeny and diversification of freshwater shrimps (Decapoda, Atyidae, Caridina) from ancient Lake Poso, The importance of being colourful, vol.45, pp.1033-1041, 2007.

,

F. Ronquist and J. P. Huelsenbeck, MRBAYES 3: Bayesian phylogenetic inference under mixed models, Bioinformatics, vol.19, issue.12, pp.1572-1574, 2003.

,

F. Rougerie and B. Wauthy, The endo--upwelling concept: from geothermal convection to reef construction, Coral Reefs, vol.12, issue.1, pp.19-30, 1993.

J. Roux, Décapodes d'eau douce de Célèbes (Genres Caridina & Potamon), Revue Suisse de Zoologie, vol.12, issue.3, pp.539-572, 1904.

J. Roux, Nouvelles espèces de décapodes d'eau douce provenant de Papouasie, Notes from the Leyden Museum, vol.33, pp.81-106, 1911.

J. Roux, Süßwasserdekapoden von den Aru--und Kei--Inseln, Abhandlungen der Senckenbergischen Naturforschenden Gesellschaft, vol.35, pp.317-351, 1920.

J. Roux, Crustacés décapodes d'eau douce de la Nouvelle--Calédonie, Nova Caledonia. Forschungen in Neu-Caledonien und auf der Loyalty-Inseln. A. Zoologie, vol.4, pp.179-240, 1926.

J. Roux, Notes carcinologiques de l'archipel indo--australien. Treubia, vol.10, pp.197-224, 1928.

J. Roux, . I. Crustacea, and . Atyidae, Contribution à l'étude de la faune de Madagascar In, Faune des colonies françaises, vol.215, pp.293-319, 1929.

J. Roux, Süßwassermacruren der Deutschen Limnologischen Sunda--Expedition, Archiv für Hydrobiologie, Supp, vol.11, pp.563-574, 1932.

J. Roux, Notes de carcinologie mélanésienne. I. Décapodes d'eau douce de l'Archipel Bismarck et des îles de l'Amirauté, Revue Suisse de Zoologie, vol.41, pp.217-229, 1934.

P. Roux, Mémoire sur la classification des Crustacés de la tribu des Salicoques, 1831.

P. Roux, Lettre relative à divers Coquilles, Crustacés, Insectes, reptiles et Oiseaux, observés en Egypte; adressée par M. Roux à M. le Baron de Férussac, Annales des Sciences Naturelles, vol.28, pp.72-78, 1833.

P. Roux, Lettre de M. Polydore Roux adressée à M. le Baron de Férussac et datée de Bombay, 15 juin 1832, Annales de Sciences Naturelles, vol.2, issue.2, pp.99-104, 1834.

P. Roux, Éloge Historique de Polydore Roux conservateur du Cabinet d'histoire naturelle de la ville de Marseille, member de plusieurs sociétés savantes nationales et étrangères. Muséum d'histoire naturelle de Marseille, 1834.

D. Russi, P. Brink, A. Farmer, T. Badura, D. Coates et al., The Economics of Ecosystems and Biodiversity for Water and Wetlands, IEEP, 2013.

S. D. Salman, Larval Development of Caridina babaulti basrensis Al--Adhub & Hamzah (Decapoda, Caridea, Atyidae) Reared in the Laboratory, Crustaceana, vol.52, issue.3, pp.229-244, 1987.

E. Schenkel, Beitrag zur Kenntnis der Dekapodenfauna von Celebes. Verhandlungen der Naturforschenden Gesellschaft in Basel, vol.13, pp.485-585, 1902.

-. Schlick, B. C. Steiner, F. M. Steiner, B. Seifert, C. Stauffer et al., Integrative taxonomy: a multisource approach to exploring biodiversity, Annual Review of Entomology, vol.55, pp.421-438, 2010.

C. E. Schweitzer, R. M. Feldman, A. Garassino, H. Karasawa, and G. Schweigert, Systematic list of fossil decapod crustacean species, Crustaceana Monographs, 2010.

L. Brill, T. Netherlands, M. A. Boston, and U. ,

B. Seidl, K. Huemer, F. Neues, S. Hild, M. Epple et al., Ultrastructure and mineral distribution in the tergite cuticle of the beach isopod Tylos europaeus Arcangeli, Journal of Structural Biology, vol.174, pp.512-526, 1938.

K. Shen, Y. Lee, and W. Tzeng, Use of Otolith Microchemistry to Investigate the Life History Pattern of Gobies in a Taiwanese Stream, Zoological Studies, vol.37, issue.4, pp.322-329, 1998.

S. Shokita, Abbreviated Larval Development of Fresh--water Atyid Shrimp, Caridina brevirostris Stimpson from Iriomote Island of the Ryukyus (Decapoda, Atyidae), Mathematics & natural sciences, vol.16, pp.222-231, 1973.

S. Shokita, Early life--history of the land--locked atyid shrimp, Caridina denticulata ishigakiensis Fujino et Shokita, from the Ryukyu Islands, Researches on Crustacea, vol.7, pp.1-10, 1976.

S. Shokita, Life history of the family Atyidae (Decapoda, Caridea), vol.12, pp.15-23, 1981.

S. Shokita, The flora and fauna of inland waters in the Ryukyu Islands, pp.249-254, 2003.

J. W. Short, Freshwater Crustacea of the Mimika Region, Kuala Kencana, Timika (96p), 2009.

J. W. Short and E. Doumenq, Atyidae and Palaemonidae, freshwater shrimps, pp.603-608, 2003.

J. Shy, W. H. Liou, and H. P. Yu, Morphological observation on the development of larval Neocaridina brevirostris Stimpson, 1860 (Crustacea: Decapoda: Atyidae) reared in the laboratory, Journal of the Fisheries Society of Taiwan, vol.14, issue.1, pp.15-24, 1987.

J. Shy and H. P. Yu, Freshwater shrimps of Taiwan. National Museum of Marine Biology and Aquarium Press, 1998.

G. G. Simpson, The Species Concept. Evolution, vol.5, issue.4, pp.285-298, 1951.

B. Sket and V. Zaksek, European cave shrimp species (Decapoda: Caridea: Atyidae), redefined after a phylogenetic study; redefinition of some taxa, a new genus and four new Troglocaris species, Zoological Journal of the Linnean Society, vol.155, pp.786-818, 2009.

S. I. Smith, Report on the decapod Crustacea of the Albatross dredgings off the East coast of the United States in 1883, Reports of the United States Fisheries Commission, vol.10, pp.345-426, 1884.

P. H. Sneath and R. R. Sokal, Numerical taxonomy: the principles and practice of numerical classification, 1973.

R. R. Sokal and T. J. Crovello, The biological species concept: A critical evaluation, The American Naturalist, vol.104, pp.127-153, 1970.

D. H. Spaargaren, Shape and hydrodynamic properties in relation to size in marine macro--crustacea, Crustaceana, vol.72, issue.2, pp.203-214, 1999.

,

M. D. Spalding, H. E. Fox, G. R. Allen, N. Davidson, Z. A. Ferdana et al., Marine Ecoregions of the World: A Bioregionalization of Coastal and Shelf Areas, BioScience, vol.57, issue.7, pp.573-584, 2007.

A. Stamatakis, RAxML--VI--HPC: maximum likelihood--based phylogenetic analyses with thousands of taxa and mixed models, Bioinformatics, vol.22, issue.21, pp.2688-2690, 2006.

A. Stamatakis, RAxML version 8: a tool for phylogenetic analysis and post--analysis of large phylogenies, Bioinformatics, vol.30, issue.9, pp.1312-1313, 2014.

W. Stimpson, Prodromus descriptionis animalium evertebratorum, quae in Expeditione ad Oceanum Pacificum Septentrionalem, a Republic Federata missa, Cadwaladore Ringgold et Johanne Rodgers Ducibus, observavit et descripsit. Pars VIII, Crustacea Macrura, Proceedings of the Academy of Natural Sciences of Philadelphia, vol.1860, pp.22-47, 1860.

L. Taillebois, M. Castelin, J. R. Ovenden, C. Bonillo, and P. Keith, Contrasting Genetic Structure among Populations of Two Amphidromous Fish Species (Sicydiinae) in the Central West Pacific, PLoS ONE, vol.8, issue.10, p.75465, 2013.

L. Taillebois, M. Castelin, J. R. Ovenden, and P. Keith, Geographic range and connectivity across the intermittent Torres Strait Barrier leads to contrasting phylogeography in three similar amphidromous goby species (Sicydiinae), PLoS ONE, vol.8, issue.10, p.75465, 2013.

G. Talavera and J. Castresana, Improvement of phylogenies after removing divergent and ambiguously aligned blocks from protein sequence alignments, Systematic Biology, vol.56, issue.4, pp.564-577, 2007.

,

K. Tamura, G. Stecher, D. Peterson, A. Filipski, and S. Kumar, MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0. Molecular Biology and Evolution, vol.30, pp.2725-2729, 2013.

D. Tautz, P. Arctander, A. Minelli, R. H. Thomas, and A. P. Vogler, A plea for DNA taxonomy, Trends in Ecology & Evolution, vol.18, issue.2, pp.70-74, 2003.

, , pp.41-42

F. Teletchea, After 7 years and 1000 citations: Comparative assessment of the DNA barcoding and the DNA taxonomy proposals for taxonomists and non--taxonomists, Mitochondrial DNA, vol.21, pp.206-226, 2010.

,

A. R. Templeton, The meaning of species and speciation: A genetic perspective, Speciation and its consequences. Sinauer Associates, 1989.

A. R. Templeton, Species and speciation: Geography, population structure, ecology, and gene trees, pp.32-43, 1998.

P. R. Teske, I. Papadopoulos, B. K. Newman, P. C. Dworschak, C. D. Mcquaid et al., Oceanic dispersal barriers, adaptation and larval retention: an interdisciplinary assessment of potential factors maintaining a phylogeographic break between sister lineages of an African prawn, BMC Evolutionary Biology, vol.8, issue.341, pp.1-14, 2008.

M. Thomas, V. K. Pillai, and N. N. Pillai, Atyidae: Caridina) from the Cochin Backwater, Caridina pseudogracilirostris sp.nov, vol.15, pp.871-872, 1973.

P. A. Thuesen, B. C. Ebner, B. C. Larson, P. Keith, R. M. Silcock et al., Amphidromy links a newly documented fish community of continental Australian streams to oceanic islands of the West Pacific, PLoS ONE, vol.6, p.26685, 2011.

K. K. Tiwari, R. S. Pillai, K. K. Tiwari, and R. S. Pillai, Atyid shrimps of the genus Caridina H. Milne Edwards, 1837, from the Andaman islands (Decapoda, Caridea), Crustaceana, vol.21, issue.1, pp.79-91, 1971.

J. I. Tracey, S. O. Schlanger, J. T. Stark, D. B. Doan, and H. G. May, General Geology of Guam, Geological Survey Professional Papers, pp.1-104, 1964.

D. F. Travis, The molting cycle of the spiny lobster, Panulirus argus Latreille. II. Pre--ecdysial histological and histochemical changes in the hepatopancreas and integumental tissues, Biological Bulletin, vol.108, issue.1, pp.88-112, 1955.

,

D. F. Travis, Structural features of mineralization from tissue to macromolecular levels of organization in the decapod Crustacea, Annals of the New York Academy of Sciences, vol.109, issue.1, pp.177-245, 1963.

L. M. Tsang, T. Chan, S. T. Ahyong, and K. H. Chu, Hermit to king, or hermit to all: multiple transitions to crab--like forms from hermit crab ancestors, Systematic Biology, vol.60, pp.616-629, 2011.

L. M. Tsang, K. Y. Ma, S. T. Ahyong, T. Chan, and K. H. Chu, Phylogeny of Decapoda using two nuclear protein--coding genes: origin and evolution of the Reptantia, Molecular Phylogenetics and Evolution, vol.48, pp.359-368, 2008.

K. Tsukamoto, T. Otake, N. Mochioka, T. Lee, H. Fricke et al., Seamounts, New Moon and eel Spawning: The Search for the Spawning Site of the Japanese eel, Environmental Biology of Fishes, vol.66, issue.3, pp.221-229, 2003.

M. Ueno, Inland water fauna of Formosa. I. Crustacea Decapoda. Transactions of the Natural History Society of Formosa, vol.25, pp.270-276, 1935.

L. Van-valen, Ecological Species, Multispecies and Oaks, Taxon, vol.25, issue.2--3, pp.233-239, 1976.

G. J. Vermeij, The dispersal barrier in the tropical Pacific: implications for molluscan speciation and extinction, Evolution, vol.41, issue.5, pp.1046-1058, 1987.

J. E. Veron, L. M. Devantier, E. Turak, A. L. Green, S. Kininmonth et al., Delineating the Coral Triangle, Journal of Coral Reef Studies, vol.11, issue.2, pp.91-100, 2009.

L. Vía, Crustaceos Decapodos del Jurasico superior del Montsec (Lérida), 1971.

C. Geología-ibérica, , vol.2, pp.607-612

F. A. Villalobos, Un nuevo genero de Atyidae (Crustacea, Decapoda), procedente de la Isla de Cocos, Anales del Instituto de Biologiá, vol.30, issue.1, pp.331-347, 1960.

M. Voss--foucart and C. Jeuniaux, Etude comparée de la couche principale et de la couche membraneuse de la cuticule chez six espèces de crustacés décapodes, Archives de Zoologie Expérimentale et Générale, vol.119, pp.127-142, 1978.

A. R. Wallace, On the physical geography of the Malay Archipelago, The Journal of the Royal Society of London, vol.33, pp.217-234, 1863.

C. J. Walsh, Decapoda: Caridea: Atyidae), Reared in the Laboratory, With Comparisons of Fecundity and Egg and Larval Size Between Estuarine and Riverine Environments, Journal of Crustacean Biology, vol.13, issue.3, pp.456-480, 1917.

M. Weber, Beiträge zur Kenntniss der Fauna von Süd--Afrika. I. Zur Kenntniss der Süsswasser--Fauna von Süd--Afrika, Zoologische Jahrbucher supplement, vol.10, pp.135-199, 1897.

M. Weber, Der Indo-Australische Archipel und die Geschichte seiner Tierwelt, 1902.

E. O. Wiley, The evolutionary species concept reconsidered, Systematic Zoology, vol.27, issue.1, pp.17-26, 1978.

K. W. Will, B. D. Mishler, and Q. D. Wheeler, The perils of DNA barcoding and the need for integrative taxonomy, Systematic Biology, vol.54, issue.5, pp.844-851, 2005.

J. L. Williams, Effects of the Tropical Freshwater Shrimp Caridina weberi (Atyidae) on Leaf Litter Decomposition, Biotropica, vol.34, issue.4, pp.616-619, 2002.

M. R. Willig, D. M. Kaufman, and R. D. Stevens, Latitudinal gradients of biodiversity: Pattern, Process, Scale, and Synthesis, Evolution, and Systematics, vol.34, issue.1, pp.273-309, 2003.

,

E. Woltereck, Zur Systematik und geographischen Verbreitung der Caridinen, International Review of Hydrobiology, vol.34, issue.1, pp.294-330, 1937.

L. E. Wood, S. R. Daniels, and S. De-grave, Caridina susuroflabra Richard & Clark, 2009 is a junior synonym of the widespread Caridina africana Kingsley, 1882 (Decapoda, Atyidae), Crustaceana, vol.91, issue.2, pp.243-249, 2018.

,

D. Wowor, Y. Cai, and P. K. Ng, The freshwater invertebrates of the Malaysian region, Malaysian Academy of Sciences, pp.337-357, 2004.

G. Xu, F. Du, Z. Nie, P. Xu, and R. Gu, Complete mitochondrial genome of Caridina nilotica gracilipes, Mitochondrial DNA Part A DNA Mapping, Sequencing, and Analysis, vol.27, pp.1249-1250, 2016.

R. S. Yam, Functional morphology of the feeding and associated appendages of the detritivore--collector atyid shrimps, Caridina cantonensis and Caridina trifasciata -a scanning electron microscopy study, Crustaceana, vol.89, issue.3, pp.359-368, 2016.

M. Yatsuya, M. Ueno, and Y. Yamashita, Life history of the amphidromous shrimp Caridina leucosticta (Decapoda: Caridea: Atyidae) in the Isazu River, Japan. Journal of Crustacean Biology, vol.33, issue.4, pp.488-502, 2013.

,

D. C. Yeo, Y. Cai, and P. K. Ng, The freshwater and terrestrial decapod crustacea of Pulau Tioman, Peninsular Malaysia. The Raffles Bulletin of Zoology, Supp, vol.6, pp.197-244, 1999.

H. P. Yu, On the Atyid shrimps (Crustacea, Decapoda, Atyidae) from Taiwan, Aquaculture, vol.2, pp.49-58, 1974.

Y. Yu, A. J. Harris, C. Blair, and X. He, RASP (Reconstruct Ancestral State in Phylogenies): A tool for historical biogeography, Molecular Phylogenetics and Evolution, vol.87, pp.46-49, 2015.

M. L. Zelditch, D. L. Swiderski, H. D. Sheets, and W. L. Fink, Geometric morphometrics for biologists: a primer, 2004.

J. Zhang and X. Sun, Studies on the larval development of six freshwater prawn species in the middle and lower Chang Jiang (Yangtze) Valley, Acta Zoologica Sinica, vol.25, pp.143-153, 1979.

G. Zimmermann, P. Bosc, P. Valade, R. Cornette, N. Améziane et al., Geometric morphometrics of carapace of Macrobrachium australe (Crustacea: Palaemonidae) from Reunion Island, Acta Zoologica, vol.93, issue.4, pp.492-500, 2012.

, Plonger les morceaux de tissus dans 600 µl de CTAB préchauffé à 60°C au bain--marie

, Ajouter 500 µl de CIA (96 % Chloroforme 4 % Isoamyle Alcool) ? Mélanger manuellement pendant 2 minutes ? Centrifuger à 4°C et à 15 000 g pendant 10 minutes ? Récupérer la phase aqueuse surnageante

, Précipitation ? Ajouter 250 µl d'isopropanol froid et 1 µg de RNA carrier ? Laisser une nuit au congélateur à, p.20

, Récupération du culot ? Centrifuger à 4°C et à 15 000 g pendant 10 minutes ? Jeter le surnageant ? Ajouter 500 µl d'éthanol 95 % froid ? Centrifuger à 4°C et à 15 000 g pendant 10 minutes ? Jeter le surnageant ? Laisser sécher les tubes sous la hotte ? Re

, Protocole de séquençage 1. Purification ExoSap Mix ExoSap : ? 0,15 µl d'Exonucléase 1 ? 0,2 µl de Phosphatase alcaline ? 1 µl de tampon de Phosphatase, Annexe, vol.5

, 1 µl d'eau distillée ? 2 µl de tampon ? 0,5 µl d'amorce (1,5 pM) 2 min à 2000 rpm ? Déposer le produit de séquençage au centre de la colonne de Sephadex ? Centrifuger 2 min à 2300 rpm ? Si besoin, vol.6

R. Bouvier and E. , Recherches sur la morphologie, les variations et la distribution systématique des crevettes d'eau douce de la famille des Atyidés, Encyclopédie Entomologique, vol.4, 1925.

Y. Cai and P. K. Ng, A revision of the Caridina serrata species group, with descriptions of five new species (Crustacea: Decapoda: Caridea: Atyidae), Journal of Natural History, vol.33, pp.1603-1638, 1999.

Y. Cai and P. K. Ng, A revision of the Caridina gracilirostris De Man, 1892, species group, with descriptions of two new taxa (Decapoda; Caridea, 2007.

. Atyidae, Journal of Natural History, vol.41, pp.1585-1602

C. O. Coleman, Digital inking': How to make perfect line drawings on computers, Organisms Diversity and Evolution, vol.3, p.303, 2003.

C. O. Coleman, Substituting time-consuming pencil drawings in arthropod taxonomy using stacks of digital photographs, Zootaxa, vol.1360, pp.61-68, 2006.

A. P. Covich, M. A. Palmer, and T. A. Crowl, The role of benthic invertebrate species in freshwater ecosystems, Bioscience, vol.49, pp.119-128, 1999.

S. De-grave, K. G. Smith, N. A. Adeler, D. J. Allen, F. Alvarez et al., Dead shrimp blues: a global assessment of extinction risk in freshwater shrimps (Crustacea: Decapoda: Caridea), PLoS One, vol.10, 2015.

R. C. Edgar, MUSCLE: multiple sequence alignment with high accuracy and high throughput, Nucleic Acids Research, vol.32, pp.1792-1797, 2004.

J. Felsenstein, Confidence limits on phylogenies: an approach using the bootstrap, Evolution, vol.39, pp.783-791, 1985.

G. Fryer, Evolution in ancient lakes: radiation of Tanganyikan atyid prawns and speciation of pelagic cichlid fishes in Lake Malawi, Hydrobiologia, vol.568, pp.131-142, 2006.

P. Gerbeaux, J. Goodman, G. Marquet, and P. Keith, Freshwater survey of Laulii-Falevao (Upolu) and Mt Salefai (Savai) -Freshwater Contribution to a MNRE funded project for the integration of Climate Change Risks and resilience into Forestry Management in Samoa (ICCRIFS) Project, 2014.

T. A. Hall, BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT, Nucleic Acids Symposium Series, vol.41, pp.95-98, 1999.

K. I. Hayashi and T. Hamano, The complete larval development of Caridina japonica, Zoological Science, vol.1, pp.571-589, 1984.

J. P. Huelsenbeck and F. Ronquist, MrBayes: a program for the Bayesian inference of phylogeny, Bioinformatics, vol.17, pp.754-755, 2001.

J. Jugovic, S. Prevorcnik, G. Aljancic, and B. Sket, The atyid shrimp (Crustacea: Decapoda: Atyidae) rostrum: phylogeny versus adaptation, taxonomy versus trophic ecology, Journal of Natural History, vol.44, pp.2509-2533, 2010.

A. Karge and W. Klotz, , 2008.

P. Keith, G. Marquet, C. Lord, D. Kalfatak, and E. Vigneux, Vanuatu freshwater fish and crustaceans. Société Française d'Ichtyologie, 2010.

W. Klotz, A. Karge, and K. Von-rintelen, A redescription of two atyid shrimps (Decapoda: Caridina) from Central Sulawesi, Zootaxa, vol.1466, pp.1-10, 2007.

W. Klotz and T. Von-rintelen, To 'bee' or not to be -on some ornamental shrimp from Guangdong Province, southern China and Hong Kong SAR, with descriptions of three new species, Zootaxa, vol.3889, pp.151-184, 2014.

R. Lanfear, B. Calcott, S. Y. Ho, and S. Guindon, PartitionFinder: combined selection of partitioning schemes and substitution models for phylogenetic analyses, Molecular Biology and Evolution, vol.29, pp.1695-1701, 2012.
URL : https://hal.archives-ouvertes.fr/lirmm-00705211

G. Marquet, P. Keith, and D. Kalfatak, Caridina gueryi, a new species of freshwater shrimp (Decapoda, Atyidae) from Santo island, Crustaceana, vol.82, pp.159-166, 2009.
URL : https://hal.archives-ouvertes.fr/hal-00440328

M. A. Miller, W. Pfeiffer, and T. Schwartz, Creating the CIPRES Science Gateway for inference of large phylogenetic trees, Proceedings of the Gateway Computing Environments Workshop (GCE), pp.1-8, 2010.

T. J. Page and J. M. Hughes, Neither molecular nor morphological data have all the answers; with an example from Macrobrachium (Decapoda: Palaemonidae) from Australia, Zootaxa, vol.2874, pp.65-68, 2011.

T. Page, S. Choy, and J. Hughes, The taxonomic feedback loop: symbiosis of morphology and molecules, Biology Letters, vol.1, pp.139-142, 2005.

T. J. Page, K. Von-rintelen, and J. M. Hughes, An island in the stream: Australia's place in the cosmopolitan world of Indo-West Pacific freshwater shrimp (Decapoda: Atyidae: Caridina), Molecular Phylogenetics and Evolution, vol.43, pp.645-659, 2007.

S. R. Palumbi, Nucleic acids II: the polymerase chain reaction, pp.205-247, 1996.

C. M. Pringle, G. A. Blake, A. P. Covich, K. M. Buzby, F. et al., Effects of omnivorous shrimp in a montane tropical stream: sediment removal, disturbance of sessile invertebrates and enhancement of understory algal biomass, Oecologia, vol.93, pp.1-11, 1993.

J. Richard and P. F. Clark, African Caridina (Crustacea: Decapoda: Caridea: Atyidae): redescriptions of C. africana Kingsley, 1882, C. togoensis Hilgendorf, 1893, C. natalensis Bouvier, 1925 and C. roubaudi Bouvier, 1925 with descriptions of 14 new species, Zootaxa, pp.1-75, 1995.

J. Richard and P. F. Clark, Crustacea: Decapoda: Caridea: Atyoidea: Atyidae) and the synonymy by Johnson, vol.3841, pp.301-338, 1904.

J. Roux, Notes de carcinologie mélanésienne. I. Décapodes d'eau douce de l'Archipel Bismarck et des îles de l'Amirauté, Revue Suisse de Zoologie, vol.41, pp.217-234, 1934.

A. Stamatakis, RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models, Bioinformatics, vol.22, pp.2688-2690, 2006.

G. Talavera and J. Castresana, Improvement of phylogenies after removing divergent and ambiguously aligned blocks from protein sequence alignments, Systematic Biology, vol.56, pp.564-577, 2007.

K. Tamura, G. Stetcher, D. Peterson, A. Filipski, and S. Kumar, MEGA6: molecular evolutionary genetics analysis version 6.0, Molecular Biology and Evolution, vol.30, pp.2725-2729, 2013.

K. Von-rintelen and Y. Cai, Radiation of endemic species flocks in ancient lakes: systematic revision of the freshwater shrimp Caridina H. Milne Edwards, 1837 (Crustacea: Decapoda: Atyidae) from the ancient lakes of Sulawesi, Indonesia, with the description of eight new species, The Raffles Bulletin of Zoology, vol.57, pp.343-452, 2009.

K. Von-rintelen, A. Karge, and W. Klotz, News from a small islandfirst record of a freshwater shrimp, 2008.

B. Peleng and . Islands, Indonesia. Journal of Natural History, vol.42, pp.2243-2256

R. Chapman, Conventional Procrustes approaches, Proceedings of the Michigan Morphometrics Workshop, pp.251-267, 1990.

, Figure 5. Correlation scatterplot of the rostrum length over carapace length with elevation. Some of the specimens are illustrated to show the variation

A. P. Covich, T. A. Crowl, C. L. Hein, M. J. Townsend, and W. H. Mcdowell, Predator-prey interactions in river networks: comparing shrimp spatial refugia in two drainage basins, Freshwater Biology, vol.54, pp.450-465, 2009.

A. P. Covich, M. A. Palmer, and T. A. Crowl, The role of benthic invertebrate species in freshwater ecosystems, BioScience, vol.49, pp.119-128, 1999.

S. De-grave, Rostral variation in Palaemon concinnus Dana, 1852 (Decapoda, Palaemonidae), Crustaceana, vol.72, pp.701-704, 1999.

S. De-grave, K. G. Smith, N. A. Adeler, D. J. Allen, F. Alvarez et al., Dead shrimp blues: A global assessment of extinction risk in freshwater shrimps (Crustacea: Decapoda: Caridea), PLoS ONE, vol.10, p.120198, 2015.

A. Dimmock, I. Williamson, and P. B. Mather, The influence of environment on the morphology of Macrobrachium australiense (Decapoda: Palaemonidae), Aquaculture International, vol.12, pp.435-456, 2004.

T. E. Eichhorst, Neritidae of the world, vol.1, 2016.

F. E. Guérin and L. I. Duperry, Voyage autour du monde, exécuté par Ordre du Roi, sur la corvette de Sa Majesté, la Coquille, pendant les années 1822, 1823, 1824 et 1825, An evaluation of members of the genera Clithon Montfort, 1810 and Neritina Lamarck 1816 (Gastropoda: Neritidae), 2005.

, Molluscan Research, vol.25, pp.75-84

L. B. Holthuis, A collection of Decapod Crustacea from Sumba, Lesser Sunda islands, Indonesia. Zoologische Verhandelingen, vol.162, pp.1-55, 1978.

J. Jugovic, S. Prevorcnik, G. Aljancic, and B. Sket, The atyid shrimp (Crustacea: Decapoda: Atyidae) rostrum: phylogeny versus adaptation, taxonomy versus trophic ecology, Journal of Natural History, vol.44, pp.2509-2533, 2010.

P. Keith, P. Gerbeaux, G. Marquet, L. Taillebois, and M. Castelin, Freshwater survey of Pohnpei, Muséum national d'Histoire naturelle, 2012.

P. Keith, G. Marquet, C. Lord, D. Kalfatak, and E. Vigneux, Vanuatu freshwater fish and crustaceans. Société Française d'Ichtyologie, 2010.

T. Leberer and Y. Cai, Shrimps of the family Atyidae from Guam, Mariana Islands. Micronesica, pp.353-358, 2003.

C. L. Lee and D. R. Fielder, The effect of salinity and temperature on the larval development of the freshwater prawn Macrobrachium australiense Holthuis, 1950 from south eastern Queensland, Australia. Aquaculture, vol.26, pp.167-173, 1981.

V. Mazancourt, . De, G. Marquet, W. Klotz, P. Keith et al., When morphology and molecules work together: lines of evidence for the validity of Caridina buehleri Roux, Crustacea: Decapoda: Atyidae) and Caridina gueryi Marquet, Keith & Kalfatak, 2009 as its junior synonym. Invertebrate Systematics, 1934.
URL : https://hal.archives-ouvertes.fr/hal-02171153

J. G. Man and . De, On Caridina nilotica (Roux) and its varieties, Records of the Indian Museum, vol.2, pp.255-283, 1908.

H. Milne-edwards, Histoire naturelle des Crustacés, comprenant l´anatomie, la physiologie et la classification de ces animaux, vol.2, 1837.

P. K. Ng, Collecting and processing freshwater shrimps and crabs, Journal of Crustacean Biology, vol.37, pp.115-122, 2017.

M. E. Ocasio-torres, T. A. Crowl, and A. M. Sabat, Long rostrum in an amphidromous shrimp induced by chemical signals from a predatory fish, Freshwater Science, vol.33, pp.451-458, 2014.

M. E. Ocasio-torres, T. Giray, T. A. Crowl, and A. M. Sabat, Antipredator defence mechanism in the amphidromous shrimp Xiphocaris elongata (Decapoda: Xiphocarididae): rostrum length, Journal of Natural History, vol.49, pp.1493-1506, 2015.

T. J. Page, S. C. Choy, and J. M. Hughes, The Taxonomic Feedback Loop: symbiosis of morphology & molecules, Biology Letters, vol.1, pp.139-142, 2005.

T. J. Page and J. M. Hughes, Neither molecular nor morphological data have all the answers; with an example from Macrobrachium (Decapoda: Palaemonidae) from Australia, Zootaxa, vol.2874, pp.65-68, 2011.

C. M. Pringle, G. A. Blake, A. P. Covich, K. M. Buzby, and A. Finley, Effects of omnivorous shrimp in a montane tropical stream: sediment removal, disturbance of sessile invertebrates and enhancement of understory algal biomass, Oecologia, vol.93, pp.1-11, 1993.

O. Pérez-reyes, T. A. Crowl, and A. P. Covich, Effects of food supplies and water temperature on growth rates of two species of freshwater tropical shrimps, Freshwater Biology, vol.60, pp.1514-1524, 2015.

J. Roux, Nouvelles espèces de décapodes d'eau douce provenant de Papouasie, Notes from the Leyden Museum, vol.33, pp.81-106, 1911.

D. H. Spaargaren, Shape and hydrodynamic properties in relation to size in marine macro-crustacea, Crustaceana, vol.72, pp.203-214, 1999.

M. Zelditch, D. Swiderski, D. H. Sheets, and W. Fink, Geometric morphometrics for biologists: a primer, 2004.

G. Zimmermann, P. Bosc, P. Valade, R. Cornette, N. Améziane et al., Geometric morphometrics of carapace of Macrobrachium australe (Crustacea: Palaemonidae) from Reunion Island, 2012.

, Acta Zoologica, vol.93, pp.492-500

, Bouvier (1925) reported six specimens belonging to C. nilotica brachydactyla De Man, 1908 (A. Marche coll.) with a short rostrum armed to the tip on both margins. Specimens are deposited in MNHN (MNHN-IU-2015-1824), View publication stats View publication stats From the Mariana Islands (with no island specified), 2001.

. Keith, Amplification products were generated by an initial denaturation step of 4 min at 94°C followed by 35 cycles of denaturation at 94°C for 30s, annealing at 52°C for 40 s, extension at 72°C for 60 s and a final extension step at 72°C for 7 min. For old collection specimens (Syntypes of C. mertoni), a CTAB protocol was used to extract DNA from pleopods. A shorter fragment of the 16S rRNA (332 bp) was amplified using two newly designed primers: 16S-Car-81F (AGGTAGCATAATAAATAGTC) and 16S-Car-413R (CTGTTATCCCTAAAGTAAC). DNA amplification was performed in 25µl PCR reactions, containing 2.5 mM MgCl2, 0.26 mM of each nucleotide, 0.3 µM of each primer, 1 ng of BSA and 1.5 units of QBIOTAQ polymerase (MPBiomedicals), C. longirostris became C. brachydactyla and C. nilotica became C. mertoni Roux, 1911 in the Pacific. Recently one of us (DCR in March 2015) collected various Caridina from Guam, with some specimens bearing a long rostrum and attributed to C. brachydactyla, whereas others, with a short rostrum, were identified as C. mertoni following the previous identifications made by Leberer & Cai, 2003. Bright (1979) reported C. brachydactyla from Palau among seven Atyid species, depositing them at the USNM (USNM 172589 and USNM 172590), 2003.

(. D. Guam, A. Christopher-rogers, and T. Farahi, Jones coll.) 30/01-03/02/2011 13°28.168'N 144°42.762'E Assan 11-16 national d'Histoire naturelle, Paris: MNHN; Naturhistorisches Museum Basel, Basel: NMB; National Museum of Natural History

R. Van-natuurlijke-historie, Naturalis Biodiversity Center

, ) by tracing vectorial paths on stacks of high-resolution photographs using Adobe Illustrator (CS6) and a WACOM MPTZ-1230 graphic tablet. PCA for some museum specimens. Some museum specimens, for which DNA could not be retrieved for a genetic analysis, but still having all their pereiopods, were measured and included in a PCA with our recent sequenced specimens and old specimens that yielded DNA. We followed the method proposed by Konan et al (2010) using Statistica v.10 software (Statsoft). The same 19 ratios and counts used in previous work (de Mazancourt et al, 2017) were used for the analysis, ZRC Abbreviations for morphological analyses. The following abbreviations are used in the present text: cl, carapace length (mm): measured from the post-orbital margin to the posterior margin of the carapace. P1: first pereiopod. P2: second pereiopod. P3: third pereiopod. P5: fifth pereiopod. Pl1: first pleopod, 2004.

. Indonesia, Aru Island, Syntypes C. mertoni. NMB 693a one male cl 2.7 mm; NMB 693b one male 3.1 mm

, Lectotype C. brachydactyla ZMA 977 one ovigerous female cl 4.8 mm, Sulawesi, Paralectotypes ZMA 2552 two ovigerous female cl, NMB 693c one non-ovigerous female

, Maximum likelihood phylogenetic tree (16S mtDNA) of the specimens. CAXXXX numbers are lab IDs of the specimens. Results Phylogenetic analyses. A total of 31 recent specimens were sequenced, including 23 of the new species (10 from Guam, 13 from Palau), 5 recent specimens of C

C. Not and . Brachydactyla, 3 mm (MNHN-IU-2017-2105 DNA: CA1544) and 1? ovig cl 4.5 mm (MNHN-IU-2017-2106 DNA: CA1538). BPBM 4227 1? ovig cl 4.4 mm, USNM 172589: 1? cl 2.5 mm and 1? cl 3.0 mm; USNM 172590: 1? cl 5.5 mm. GUAM. Assan River: DCR (D. Christopher Rogers collections) 9? cl 2.7 mm (MNHN-IU-2017-2098 DNA: CA1535), 3.5 mm (MNHN-IU-2017-2099 DNA: CA1536), 2.3 mm (MNHN-IU-2017-2100 DNA: CA1537), 2.7 mm (MNHN-IU-2017-2101 DNA: CA1539), 2.8 mm (MNHN-IU-2017-2102 DNA: CA1540), 2.4 mm (MNHN-IU-2017-2103 DNA: CA1541), 2.2 mm (MNHN-IU-2017-2104 DNA: CA1542), 2.7 mm (MNHN-IU-2017-2102 DNA: CA1543), vol.2, 2011.

, Second pereiopod 2; c. Third pereiopod; d. Fifth pereiopod; e. Dactylus of third pereiopod; f. Dactylus of fifth pereiopod; g. Male first pleopod; h. Male second pleopod; i. Eggs; j. Uropodial diaeresis; k. Pre-anal carina; l. Telson; m., n. Cephalothorax; o. General appearance; p. Right mandible; q. Left mandible; r. First maxilla; s. Second maxilla; t. Third maxilliped; u. Second maxilliped; v. First maxilliped, Zootaxa, vol.4377, issue.1, p.45, 2018.

, A NEW SPECIES OF CARIDINA FROM MICRONESIA Comparative material. -Caridina brachydactyla De Man, 1908.

, Other material: INDONESIA: C. brachydactyla: NMB 1054a, Bali, 1? cl 5.8 mm. Sulawesi, Palopo, Macaui, 63.10, 2? cl 2.7-3.7 mm; 1? ovig cl 4.3 mm and 1?, cl 4.8 mm; Palopo, Tojo, 64.10.3 1? ovig cl 4.0 mm. -Caridina mertoni Roux, 1911 Type material: INDONESIA; Cotypes: Grand Kai, RMNH 2552, 2? ovig (cl 5.3-5.4 mm)

. Nmbc, MNHN-IU-2015-1819 1? cl 3.8 mm

, 2108 DNA: CA1507), 3.7 mm (MNHN-IU-2017-2109 DNA: CA1505), 1? ovig cl 3.9 mm, 1977.

. Hong-kong, 3? cl 2.8-3.5 mm and 1? cl 4.2 mm

-. Kemp, 1? cl 3.4 mm; . Other material: SINGAPORE; Tanglin (incorrectly spelt Tangtum in NHM register and on label, Type material: Caridina brachydactyla subsp. peninsularis Kemp, p.1, 1916.

, 7-1.5 of cl, reaching to scaphocerite apex, armed dorsally with 16-24 teeth, distal unarmed portion 0.1-0.7 times that of armed portion, with one or two subapical teeth, 1-4 teeth on carapace posterior to orbital margin, ventral margin with 4-15 teeth. Number of dorsal teeth before the most proximal ventral tooth 10-17, Description. Cephalothorax. Rostrum (Fig. 4m): very variable in length, 0

, Antennular spine acute, placed slightly below orbital angle. Pterygostomian margin rectangular. Eyes well developed, anterior end reaching to 0.7 length of antennular peduncle basal antennomere

, Upper lacinia elongate, with medial margin bearing a number of distinct teeth, palp setose. Maxilla (Fig. 4s) upper and middle endite with marginal and submarginal plumose setae. Lower endite with simple setae; palp narrow, shorter than upper endite cleft with a few setae. Scaphognathite fringed with long setae, tapering posteriorly with some long, curved setae at posterior end. First maxilliped (Fig. 4v) endopodite ultimate segment medial margin with long denticulate setae, lower portion with transverse rows of simple setae. Palp elongate, setose. Exopod flagellum long and narrow distally with marginal plumose setae. Caridean lobe large, with marginal setae, Antennular peduncle (Fig. 4m, 4n, cephalothorax view, and 4o, general view) 0of antennular peduncle basal antennomere. Scaphocerite extending slightly beyond antennular peduncleapex, length about 2.8 times width

C. Kemp, This new species displays a variable rostrum length among specimens. When the rostrum is short the general appearance is like C. mertoni, whereas when the rostrum is long the general appearance is of C. brachydactyla. In C. variabilis n. sp. the antennal spine is placed below the orbital angle, the P5 dactylus is biunguiculate with 13-30 setae vs. 32-42 in C. brachydactyla and there is a very large propodus seta, whereas in C. mertoni, the antennal spine is somewhat fused with the orbital angle, possesses an unguiculate dactylus with 30-40 setae and has no prominent propodus seta. Caridina variabilis n. sp. differs from C. brachydactyla by the absence of spine on the preanal carina, a shorter distal unarmed portion of the rostrum 0.1-0.7 (vs 0.6-1.6) times that of armed portion, mm. Type Locality. Palau, Babeladob Island, Tabecheding River, 07°27.169N, 134°31.748E. Habitat. This species is found in rivers from lower to higher elevations in flowing water between riffles, 1918.

E. L. Bouvier, Recherches sur la morphologie, les variations, la distribution géographique des crevettes de la famille des Atyidés séries A, 4. Encyclopédie Entomologique, vol.370, p.716, 1925.

G. Bright, The inland water of Palau, Caroline islands, Trust territory of the Pacific islands, p.61, 1979.

A. P. Covich, M. A. Palmer, and T. A. Crowl, The role of benthic invertebrate species in freshwater ecosystems, BioScience, vol.49, pp.119-128, 1999.

S. De-grave, K. G. Smith, N. A. Adeler, D. J. Allen, F. Alvarez et al., Dead Shrimp Blues: A Global Assessment of Extinction Risk in Freshwater Shrimps (Crustacea: Decapoda: Caridea), PLoS ONE, vol.10, 2015.

W. De-haan, Fauna Japonica, sive Descriptio animalium, quae in itinere per Japoniam, jussu et auspiciis superiorum, qui summum in India Batava imperium tenent, suscepto, annis 1823-1830 collegit, notis, observationibus et adumbrationibus illustravit P.F. de Siebold. Conjunctis studiis C.J. Temminck et H, 1849.

V. I. Decas, , pp.165-196

J. G. De-man, On Caridina nilotica (Roux) and its varieties, Records of the Indian Museum, vol.2, pp.255-283, 1908.

R. C. Edgar, MUSCLE: multiple sequence alignment with high accuracy and high throughput, Nucleic Acids Research, vol.32, pp.1792-1797, 2004.

J. Felsenstein, Confidence limits on phylogenies: an approach using the bootstrap, Evolution, vol.39, pp.783-791, 1985.

J. Jugovic, S. Prevorcnik, G. Aljancic, and B. Sket, The atyid shrimp (Crystacea: Decapoda: Atyidae) rostrum: phylogeny versus adaptation, taxonomy versus trophic ecology, Journal of Natural History, vol.44, pp.2509-2533, 2010.

P. Keith, C. Lord, L. Taillebois, and P. Feutry, New data on freshwater fishes of New Caledonia, Neocaledonia & Biodiversity studies in New Caledonia. Muséum d'Histoire naturelle, pp.127-132, 2014.

P. Keith, P. Gerbeaux, G. Marquet, L. Taillebois, and M. Castelin, Freshwater survey of Babeldaob (Palau), pp.1-32, 2011.

S. Kemp, Zoological results of a tour in the Far East, Crustacea Decapoda and Stomatopoda. Memoirs of the Asiatic Society of Bengal, vol.6, pp.218-297, 1918.

K. Kobayashi, Origin of the Palau and Yap trench arc-system, Geophysical Journal International, vol.157, pp.1303-1315, 2004.

S. Kumar, G. Stecher, and K. Tamura, MEGA7: Molecular Evolutionary Genetics Analysis version 7.0 for Bigger Datasets, Molecular Biology and Evolution, vol.33, issue.7, pp.1870-1874, 2016.

R. Lanfear, B. Calcott, S. Y. Ho, and S. Guindon, PartitionFinder: combined selection of partitioning schemes and substitution models for phylogenetic analyses, Molecular Biology and Evolution, vol.29, pp.1695-1701, 2012.
URL : https://hal.archives-ouvertes.fr/lirmm-00705211

T. Leberer and S. G. Nelson, Factors affecting the distribution of atyid shrimps in two tropical insular rivers, vol.55, pp.389-398, 2001.

T. Leberer and Y. Cai, Shrimps of the family Atyidae from Guam, Mariana Islands. Micronesica, pp.353-358, 2003.

V. De-mazancourt, G. Marquet, and P. Keith, The "Pinocchio shrimp effect": First evidence of rostrum length variation with the Environment in Caridina: Crustacea: Decapoda: Atyidae), Journal of Crustacean Biology, vol.37, issue.3, pp.249-257, 2017.

M. A. Miller, W. Pfeiffer, and T. Schwartz, Creating the CIPRES Science Gateway for inference of large phylogenetic trees, Proceedings of the Gateway Computing Environments Workshop (GCE), pp.1-8, 2010.

H. Milne-edwards, Histoire Naturelle des Crustacés, Comprenant l'Anatomie, la Physiologie et la Classification de ces Animaux, Librairie de Roret, vol.2, pp.1-532, 1837.

T. J. Page, S. C. Choy, and J. M. Hughes, The Taxonomic Feedback Loop: symbiosis of morphology & molecules, Biology Letters, vol.1, pp.139-142, 2005.

T. J. Page and J. M. Hughes, Neither molecular nor morphological data have all the answers; with an example from Macrobrachium (Decapoda: Palaemonidae) from Australia, Zootaxa, vol.2874, pp.65-68, 2011.

T. J. Page, K. Von-rintelen, and J. M. Hughes, An island in the stream: Australia's place in the cosmopolitan world of Indo-West Pacific freshwater shrimp (Decapoda: Atyidae: Caridina), Molecular Phylogenetics and Evolution, vol.43, pp.645-659, 2007.

S. R. Palumbi, Nucleic acids II: the polymerase chain reaction, Molecular systematics. Sinauer Associates, pp.205-247, 1996.

L. Parenti and J. A. Maciolek, New Sicydiine Gobies from Ponape and Palau, Micronesia, with comments on Systematics of the Subfamily, Bulletin of Marine Science, vol.53, issue.3, pp.945-972, 1993.

C. M. Pringle, G. A. Blake, A. P. Covich, K. M. Buzby, and A. Finley, Effects of omnivorous shrimp in a montane tropical stream: sediment removal, disturbance of sessile invertebrates and enhancement of understory algal biomass, Oecologia, vol.93, pp.1-11, 1993.

J. Richard and P. F. Clark, African Caridina (Crustacea: Decapoda: Caridea: Atyidae): redescriptions of C. africana Kingsley, 1882, C. togoensis Hilgendorf, 1893, C. natalensis Bouvier, 1925 and C. roubaudi Bouvier, 1925 with descriptions of 14 new species, Zootaxa, pp.1-75, 1995.

J. Roux, Nouvelles espèces de Décapodes d'eau douce provenant de Papouasie. Notes from the Leyden Museum, vol.33, pp.81-106, 1911.

P. Roux, Lettre relative à divers Coquilles, Crustacés, Insectes, reptiles et Oiseaux, observés en Égypte. Annales des Sciences Naturelles, vol.28, pp.72-78, 1833.

A. Stamatakis, RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models, Bioinformatics, vol.22, pp.2688-2690, 2006.

K. Tamura, G. Stetcher, D. Peterson, A. Filipski, and S. Kumar, MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0. Molecular Biology and Evolution, vol.30, pp.2725-2729, 2013.

J. I. Tracey, S. O. Schlanger, J. T. Stark, D. B. Doan, and H. G. May, General Geology of Guam. Geological Survey Professional Papers, vol.403, pp.1-104, 1964.

. Keywords, 16S, molecular, integrative taxonomy, island, morphology

V. Mazancourt, . De, G. Marquet, and P. Keith, Caridina variabilirostris (Crustacea: Decapoda: Atyidae), a new species of freshwater shrimp from Pohnpei (Micronesia), European Journal of Taxonomy, vol.453, pp.1-16, 2018.
URL : https://hal.archives-ouvertes.fr/hal-02171169

P. Paratypes and . River,

, MNHN-IU-2018-232); 1 ?, cl 4.6 mm, same data as for preceding, 2012.

, ); 2 ??, ovig., cl. 4.1 mm (MNHN-IU-2018-241) and 4.5 mm (MNHN-IU-2018-242), same data as for preceding, 1 ? ovig., cl 4.5 mm, same data as for preceding (MNHN-IU-2018-236). -Lehn Mesi river (Station 5): 2 ??, cl 4.7 mm (MNHN-IU-2018-237) and 4.8 mm (MNHN-IU-2018-238); 1 ? ovig., cl 4.7 mm (MNHN-IU-2018-239), 2012.

D. W. Buden, D. B. Lynch, J. W. Short, and T. Leberer, Decapod crustaceans of the headwater streams of Pohnpei, eastern Caroline Islands, Federated States of Micronesia, Pacific Science, vol.55, issue.3, pp.257-265, 2001.

C. O. Coleman, Digital inking": How to make perfect line drawings on computers, Organisms Diversity and Evolution, vol.3, issue.4, pp.303-304, 2003.

C. O. Coleman, Substituting time-consuming pencil drawings in arthropod taxonomy using stacks of digital photographs, Zootaxa, vol.1360, pp.61-68, 2006.

A. P. Covich, M. A. Palmer, and T. A. Crowl, The role of benthic invertebrate species in freshwater ecosystems, BioScience, vol.49, issue.2, pp.119-128, 1999.

S. De-grave, K. G. Smith, N. A. Adeler, D. J. Allen, F. Alvarez et al., Dead shrimp blues: a global assessment of extinction risk in freshwater shrimps (Crustacea: Decapoda: Caridea), PLoS ONE, vol.10, issue.3, p.120198, 2015.

R. C. Edgar, MUSCLE: multiple sequence alignment with high accuracy and high throughput, Nucleic Acids Research, vol.32, issue.5, pp.1792-1797, 2004.

J. Felsenstein, Confidence limits on phylogenies: an approach using the bootstrap, Evolution, vol.39, pp.783-791, 1985.

M. Kearse, R. Moi, A. Wilson, S. Stones-havas, M. Cheung et al., Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data, Bioinformatics, vol.28, issue.12, pp.1647-1649, 2012.

P. Keith, P. Gerbeaux, G. Marquet, L. Taillebois, and M. Castelin, Freshwater Survey of Pohnpei. Muséum national d'Histoire naturelle, 2012.

S. Kumar, G. Stetcher, and K. Tamura, MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets, Molecular Biology and Evolution, vol.33, issue.7, pp.1870-1874, 2016.

T. Leberer and Y. Cai, Shrimps of the family Atyidae from Guam, Mariana Islands. Micronesica, pp.353-358, 2003.

J. A. Maciolek and J. L. Ford, Macrofauna and Environment of the Nanpil-Kiepw River, Bulletin of Marine Science, vol.41, issue.2, pp.623-632, 1987.

V. Mazancourt, . De, G. Marquet, and P. Keith, The "Pinocchio-shrimp effect": first evidence of rostrum length variation with the environment in Caridina H. Milne Edwards, 1837 (Crustacea: Decapoda: Atyidae), Journal of Crustacean Biology, vol.37, issue.3, pp.249-257, 2017.
URL : https://hal.archives-ouvertes.fr/hal-02171163

V. Mazancourt, . De, G. Marquet, D. C. Rogers, and P. Keith, Description of a new species of Caridina (Crustacea: Decapoda: Atyidae) from two Micronesian islands (Guam and Babeldaob), Zootaxa, vol.4377, issue.1, pp.39-50, 2018.

M. Miller, W. Pfeiffer, and T. Schwartz, Creating the CIPRES Science Gateway for Inference of Large Phylogenetic Trees, 2010.

S. G. Nelson, F. A. Camacho, J. E. Parham, R. B. Tibbats, T. Leberer et al., Surveys of the macrofauna of the Nanpil Kiepw and Lehn Mesi rivers of Pohnpei. South Pacific Regional Environment Programme, 1996.

T. J. Page and J. M. Hughes, Neither molecular nor morphological data have all the answers; with an example from Macrobrachium (Decapoda: Palaemonidae) from Australia, Zootaxa, vol.2874, pp.65-68, 2011.

T. J. Page, S. C. Choy, and J. M. Hughes, The taxonomic feedback loop: symbiosis of morphology & molecules, Biology Letters, vol.1, pp.139-142, 2005.

T. J. Page, K. Rintelen, and J. M. Hughes, An island in the stream: Australia's place in the cosmopolitan world of Indo-West Pacific freshwater shrimp (Decapoda: Atyidae: Caridina), Molecular Phylogenetics and Evolution, vol.43, pp.645-659, 2007.

S. R. Palumbi, Nucleic acids II: the polymerase chain reaction, Molecular systematics 205-247. Sinauer Associates, 1996.

C. M. Pringle, G. A. Blake, A. P. Covich, K. M. Buzby, and A. Finley, Effects of omnivorous shrimp in a montane tropical stream: sediment removal, disturbance of sessile invertebrates and enhancement of understory algal biomass, Oecologia, vol.93, pp.1-11, 1993.

H. U. Rehman, H. Nakaya, and K. Kawai, Geological Origin of the volcanic islands of the Caroline Group in the Federated States of Micronesia, Western Pacific. South Pacific Studies, vol.33, issue.2, pp.101-118, 2013.